View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20270_low_17 (Length: 310)
Name: NF20270_low_17
Description: NF20270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20270_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 40291271 - 40290982
Alignment:
| Q |
1 |
atcaggcctctaaagatgatgatgggaccgttcgaattcaacgacctcttaaagggccattttatgtctctggcaaaacgattgatgaaaacattgcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40291271 |
atcaggcctctaaagatgatgatgggaccgttcgaattcaacgacctcttaaagggccattttatgtctctggcaaaacgattgatgaaaacattgcaaa |
40291172 |
T |
 |
| Q |
101 |
tttcgtggattatgcaaggttgctttactttatagttggttttgtg----taaggatgaaaacattttttattgactaaaatttcttattaggtattgta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | | | || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40291171 |
tttcgtggattatgcaaggttgctttactttatagttggttttgtgtcttttggtctacaagaattttttattgactaaaatttcttattaggtattgta |
40291072 |
T |
 |
| Q |
197 |
aggataattctgtggccctgacaatgattggtgcttgtttactagccgcatccactgttattatcttggaaggcggcgttgcactgaaat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40291071 |
aggataattctgtggccctgacaatgattggtgcttgtttactagccgcatccactgttattatcttggaaggcggcgttgcactgaaat |
40290982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 40283803 - 40283668
Alignment:
| Q |
1 |
atcaggcctctaaagatgatgatgggaccgttcgaattcaacgacctcttaaagggccattttatgtctctggcaaaacgattgatgaaaacattgcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||| ||||||| ||||||||||||||||||||| ||||| ||||||||||| || |||||| |
|
|
| T |
40283803 |
atcaggcctctaaagatgatgacgggaccattcgaattcagcgacctcccaaagggccattttatgtctctagcaaagcgattgatgaacacgctgcaaa |
40283704 |
T |
 |
| Q |
101 |
tttcgtggattatgcaaggttgctttactttatagt |
136 |
Q |
| |
|
|| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
40283703 |
atttgtgaattatgctaggttgctttactttatagt |
40283668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 40264954 - 40264857
Alignment:
| Q |
1 |
atcaggcctctaaagatgatgatgggaccgttcgaattcaacgacctcttaaagggccattttatgtctctggcaaaacgattgatgaaaacattgca |
98 |
Q |
| |
|
|||||||||||| ||||| ||| ||||| ||||||||||| |||||| ||||| ||||||||||| || ||||||||||||||||| | |||||| |
|
|
| T |
40264954 |
atcaggcctctagagatggtgacgggactgttcgaattcagagacctcccaaaggaccattttatgtttcccgcaaaacgattgatgaacagattgca |
40264857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 40256480 - 40256380
Alignment:
| Q |
1 |
atcaggcctctaaagatgatgatgggaccgttcgaattcaacgacctcttaaagggccattttatgtctctggcaaaacgattgatgaaaacattgcaaa |
100 |
Q |
| |
|
||||||| ||||||| |||| || ||| |||||||||| ||||| ||||||||||||||||||||| |||||| ||||| ||| ||||||||| |
|
|
| T |
40256480 |
atcaggctgctaaagacgatgtcggaaccattcgaattcagcgaccctccaaagggccattttatgtctctcccaaaacaattgacgaactcattgcaaa |
40256381 |
T |
 |
| Q |
101 |
t |
101 |
Q |
| |
|
| |
|
|
| T |
40256380 |
t |
40256380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University