View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20270_low_28 (Length: 247)
Name: NF20270_low_28
Description: NF20270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20270_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 22397527 - 22397744
Alignment:
| Q |
19 |
caatttgtccatcatactactatttccaaatctctcaaacaaggaaagaaattgaaattttgaataatcatactctcgttagaacactgttttgtttggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
22397527 |
caatttgtccatcatactactatttctaaatctcgcaaacaaggaaataaattgaaatttttaataatcatagtgtcgttagaacactgttttgtttggt |
22397626 |
T |
 |
| Q |
119 |
aataccatatatcttgtggttttattatgcatgcatgagttcttctcaattttgattaagttttcactaccacatatgtgattactattgtttctattgt |
218 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22397627 |
aatactatatatcttgtggttttattatgcatgcatgagttcttctcaattttgattaagttttcactaccacatatgtgattgctattgtttctattgt |
22397726 |
T |
 |
| Q |
219 |
atatgctagtattatcta |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
22397727 |
atatgctagtattatcta |
22397744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University