View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20270_low_35 (Length: 201)
Name: NF20270_low_35
Description: NF20270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20270_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 54181386 - 54181567
Alignment:
| Q |
1 |
tctatgatgattttggaatacaaggagaggggaggtagaggggttattgtatgagagagaaaaacttgagtgttaaatgaggatttcattaagggaaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
54181386 |
tctatgatgattttggaatacaaggagaggggaggtagaggggttattgtatgagagagaaaaacttgagtgttaaatgaggatttctttaagggaaaga |
54181485 |
T |
|
| Q |
101 |
tattaaaacagaataaaaatatatttttgcccttaaaggaagagagaataataagaagaattcactgatgatacaaggaagtaaa |
185 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54181486 |
tattaaaacagaataaaaagatatttttgcccttaaaggaagagag---aataagaagaattcactgatgatacaaggaagtaaa |
54181567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University