View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20270_low_4 (Length: 458)
Name: NF20270_low_4
Description: NF20270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20270_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-137; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 164 - 415
Target Start/End: Original strand, 6375372 - 6375623
Alignment:
| Q |
164 |
cagtgttatgagtatgcacttgaaaacttgattgagattgtccatgagaatgaagaggctaagttttgtggtgcatttgagtggtaaatgaagaaagtta |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6375372 |
cagtgttatgagtatgcacttgaaaacttgattgagattgtccatgagaatgaagaggctaagttttgtggtgcatttgagtggtaaatgaagaaagtta |
6375471 |
T |
|
| Q |
264 |
tggaagtgaggtagcacttagattgagaattaacgggaattccaatgggttgttgtggctttttagatgaaaaaagtaaaagcaaacaagtttataagat |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6375472 |
tggaagtgaggtagcacttagattgagaattaacgggaattccaatgagttgttgtggctttttagatgaaaaaagtaaaagcaaacaagtttataagat |
6375571 |
T |
|
| Q |
364 |
tgttgaaagaaatggtcaacttgtgtgggatcttcaatatggaaagttgaag |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6375572 |
tgttgaaagaaatggtcaacttgtgtgggatcttcaatatggaaagttgaag |
6375623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 6 - 103
Target Start/End: Original strand, 6375214 - 6375311
Alignment:
| Q |
6 |
ggagggtcagagttcttgaggtagaacacttgatggtaatgagataattcagtgttggttgaagaagggttttgggattgaatctcttggttgttgtt |
103 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6375214 |
ggagggtcagcgttcttgaggtagaacacttgatggtaatgagataattcagtgttggttgaagaagggttttgggattgaatctcttggttgttgtt |
6375311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University