View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20272_high_5 (Length: 283)
Name: NF20272_high_5
Description: NF20272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20272_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 20 - 152
Target Start/End: Complemental strand, 15212988 - 15212856
Alignment:
| Q |
20 |
ggtttaataggtattagaaaaagaaagatttccattgaaaactggaagtataaactttgtttatattcaattaatcatactgttcctgannnnnnnnagc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
15212988 |
ggtttaataggtattagaaaaagaaagatttccattgaaaactggaagtataaactttgtttatattcaattaatcatactgttcctgattttttttagc |
15212889 |
T |
 |
| Q |
120 |
tgctttagcagccatcaaaacctcggaattgaa |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
15212888 |
tgctttagcagccatcaaaacctcggaattgaa |
15212856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 243 - 276
Target Start/End: Complemental strand, 15212857 - 15212824
Alignment:
| Q |
243 |
aacacattgtatgtaaccacattcgttcatctca |
276 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
15212857 |
aacacattgtatgcaaccacattcgttcatctca |
15212824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University