View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20273_low_6 (Length: 268)
Name: NF20273_low_6
Description: NF20273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20273_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 17 - 82
Target Start/End: Original strand, 8153873 - 8153936
Alignment:
| Q |
17 |
aataatttatgttgaagtgaagaaaagctgaaatttagattcccagatctttatttgctatgagtg |
82 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8153873 |
aataatttatggtgaagt--agaaaagctgaaatttagattcccagatctttatttgctatgagtg |
8153936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 151 - 220
Target Start/End: Original strand, 8154005 - 8154074
Alignment:
| Q |
151 |
ccacttcaaatcccgcttccatatgcaacatgttatttgcctttgnnnnnnntatagaattcccagatca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8154005 |
ccacttcaaatcccgcttccatatgcaacatgttatttgcctttgaaaaaattatagaattcccagatca |
8154074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University