View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20273_low_8 (Length: 228)
Name: NF20273_low_8
Description: NF20273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20273_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 3 - 218
Target Start/End: Original strand, 30904998 - 30905211
Alignment:
| Q |
3 |
gaagaaaatatatgttgaaattatatagttggaatggaagtccactctcctatattgttttgtttaagctaattagtttaatcatggtaagtaatagaat |
102 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30904998 |
gaagaatatatatgttgaaattatataattggaatggaattccactctcctat--tgttttgtttaagctaattagtttaatcatggtaagtaatagaat |
30905095 |
T |
 |
| Q |
103 |
tattcatgtgtaattcttatagaagatcactgaaaatattggttttcttacgtggctatgtatcattttggttttttcatggtcatagaaattacgcagc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30905096 |
tattcatgtgtaattcttatagaagatcactgaaaatattggttttcttacgcggctatgtatcattttggtttcttcatggtcatagaaattacgcagc |
30905195 |
T |
 |
| Q |
203 |
accgacgctttagatt |
218 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
30905196 |
accgacgctttagatt |
30905211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University