View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20274_high_14 (Length: 239)

Name: NF20274_high_14
Description: NF20274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20274_high_14
NF20274_high_14
[»] chr4 (1 HSPs)
chr4 (25-239)||(32009473-32009687)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 25 - 239
Target Start/End: Original strand, 32009473 - 32009687
Alignment:
25 attatttaggaaggtgatcttcatagttgagtttatttgccaagtgcatgtgctaattataaataacatttttacttgagacctaatttcttacagaaca 124  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32009473 attatttaggaaggtgatcttgatagttgagtttatttgccaagtgcatgtgctaattataaataacatttttacttgagacctaatttcttacagaaca 32009572  T
125 ataatgaaattttttggtagggctcgtgggattggaatgtcttgtgctattgggtagataattcttctgcttacatacaacttcattaagcagggcattt 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |  | || ||||||||||||||||| |||||| ||||   ||    
32009573 ataatgaaattttttggtagggctcgtgggattggaatgtcttgtgctattgggtaggttctactgctgcttacatacaacttaattaagtagggacctt 32009672  T
225 agaaatgggaatgaa 239  Q
    |||||||||||||||    
32009673 agaaatgggaatgaa 32009687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University