View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20274_high_15 (Length: 234)

Name: NF20274_high_15

Description: NF20274

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF20274_high_15

[»] chr4 (3 HSPs)

Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 3)

Name: chr4

Description:

Target: chr4; HSP #1

Raw Score: 89; E-Value: 5e-43

Query Start/End: Original strand, 18 - 114

Target Start/End: Complemental strand, 34693667 - 34693571

Alignment:

Q	18	gatcgatggttgatatgctgggatagatggagaaattaagacgaattattgaacttgaacctgaatattgaaagatatagacgattattagagagaa	114	Q
		\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	34693667	gatcgattgttgatatgctgggatagatggagaaattaagacgaattattgaacttgaacctgaatattgaaagatatagatgattattagagagaa	34693571	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2

Raw Score: 73; E-Value: 2e-33

Query Start/End: Original strand, 149 - 221

Target Start/End: Complemental strand, 34693576 - 34693504

Alignment:

Q	149	agagaaacaaacaaaaataaagaacatgaaccatgaatttgctaaacgctgtgtatatatagttgcagctttt	221	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	34693576	agagaaacaaacaaaaataaagaacatgaaccatgaatttgctaaacgctgtgtatatatagttgcagctttt	34693504	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3

Raw Score: 40; E-Value: 0.00000000000008

Query Start/End: Original strand, 18 - 117

Target Start/End: Complemental strand, 34685873 - 34685775

Alignment:

Q	18	gatcgatggttgatatgctgggatagatggagaaattaagacgaattattgaacttgaacctgaatattgaaagatatagacgattattagagagaagta	117	Q
		\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\|\|\|\|\| \|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\| \|\|\|\|\| \|\|\|\|\|\|\| \|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|
T	34685873	gatcgatcgttgatatgctgcgatagatagagaaagtaagggaaattattgaactt-aacctaaatatcaaaagatagagatgattattagagataagta	34685775	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]