View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20274_high_17 (Length: 220)
Name: NF20274_high_17
Description: NF20274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20274_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 24 - 193
Target Start/End: Complemental strand, 8846207 - 8846038
Alignment:
| Q |
24 |
agtaccacccaatttgtaaggcacatggtctccttcctattccatcttcgtggagccttaatggac-ccccaatccttacccaacttcctctcttaaaat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8846207 |
agtaccacccaatttgtaaggcacatggtctccttcctattccatcttcgtggagccttaatggaccccccaatccttacccaacttcctctcttaaaat |
8846108 |
T |
 |
| Q |
123 |
caataccatccctttcttcnnnnnnnattcattctccttttatttattgctttgttaagtccctttcattt |
193 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8846107 |
caataccatccctttcttc-ttttttattcattctccttttatttattgctttgttaagtccctttcattt |
8846038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University