View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20274_low_12 (Length: 275)
Name: NF20274_low_12
Description: NF20274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20274_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 17 - 268
Target Start/End: Complemental strand, 47822740 - 47822490
Alignment:
| Q |
17 |
aaagtttgggtgcacaactttcatgcttcatagttgttgataagtagttggttcataaaatatataaagagattcttacacaatctggtgcagactccac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47822740 |
aaagtttgggtgcacaactttcatgcttctt-gttgttgataagtagttggttcataaaatatataaagagattcttacacaatctggtgcagattccac |
47822642 |
T |
|
| Q |
117 |
aagacagaataagtatggaagtcttttgtgggatcaaaccacagataaatcctttcctctcgattgtcgaatccatctgcataaatatttgtttgaagaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47822641 |
aagacagaataagtatggaagtcttttgtgggatcaaaccacagaaaaatcctttcctctcgattgtcgaatccatctgcataaatatttgtttgaagaa |
47822542 |
T |
|
| Q |
217 |
tatatggctgtccggagacgtttccaagaaactccaagtctatttcatctct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47822541 |
tatatggctgtccggagacgtttccaagaaactccaagtctatttcatctct |
47822490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 17 - 77
Target Start/End: Original strand, 47823071 - 47823131
Alignment:
| Q |
17 |
aaagtttgggtgcacaactttcatgcttcatagttgttgataagtagttggttcataaaat |
77 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47823071 |
aaagtttggttgaacaactttcatgcttcatagttgttgatgagtagttggttcataaaat |
47823131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University