View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20274_low_16 (Length: 234)

Name: NF20274_low_16
Description: NF20274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20274_low_16
NF20274_low_16
[»] chr4 (3 HSPs)
chr4 (18-114)||(34693571-34693667)
chr4 (149-221)||(34693504-34693576)
chr4 (18-117)||(34685775-34685873)


Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 18 - 114
Target Start/End: Complemental strand, 34693667 - 34693571
Alignment:
18 gatcgatggttgatatgctgggatagatggagaaattaagacgaattattgaacttgaacctgaatattgaaagatatagacgattattagagagaa 114  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
34693667 gatcgattgttgatatgctgggatagatggagaaattaagacgaattattgaacttgaacctgaatattgaaagatatagatgattattagagagaa 34693571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 149 - 221
Target Start/End: Complemental strand, 34693576 - 34693504
Alignment:
149 agagaaacaaacaaaaataaagaacatgaaccatgaatttgctaaacgctgtgtatatatagttgcagctttt 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34693576 agagaaacaaacaaaaataaagaacatgaaccatgaatttgctaaacgctgtgtatatatagttgcagctttt 34693504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 34685873 - 34685775
Alignment:
18 gatcgatggttgatatgctgggatagatggagaaattaagacgaattattgaacttgaacctgaatattgaaagatatagacgattattagagagaagta 117  Q
    ||||||| |||||||||||| ||||||| |||||| ||||   ||||||||||||| ||||| |||||  ||||||| ||| |||||||||||| |||||    
34685873 gatcgatcgttgatatgctgcgatagatagagaaagtaagggaaattattgaactt-aacctaaatatcaaaagatagagatgattattagagataagta 34685775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University