View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20274_low_17 (Length: 231)
Name: NF20274_low_17
Description: NF20274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20274_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 220
Target Start/End: Complemental strand, 3419506 - 3419305
Alignment:
| Q |
19 |
ggcttgaaaacaaaaattgttggagcattacacaatttgttgtagccattcaattaaacgagcacgaatggacatggggtttctgttggtgaggttatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3419506 |
ggcttgaaaacaaaaattgttggagcattacacaatttgttgtagccattcaattaaacgagcacgaatggacatggggtttctgttggtgaggttatca |
3419407 |
T |
 |
| Q |
119 |
attttgttgttttgacaagaggttacccagaaactaggatagatcataaagaaggaagataaaattaaaactctttccatttataaatacaattatattc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3419406 |
attttgttgttttgacaagaggttacccagaaactaggatagatcataaagaaggaagataaaattaaaactctttccatttataaatacaattatattc |
3419307 |
T |
 |
| Q |
219 |
tt |
220 |
Q |
| |
|
|| |
|
|
| T |
3419306 |
tt |
3419305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University