View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20278_high_10 (Length: 372)
Name: NF20278_high_10
Description: NF20278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20278_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 12 - 356
Target Start/End: Original strand, 38222958 - 38223302
Alignment:
| Q |
12 |
agcagagaccaaatttacatgttttagtaaacactctgtcttcatagtcagaagaactcagaagtattttgctggtttgtcgtgatacccagatatgccc |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38222958 |
agcagaaaccaaatttacatgttttagtaaacactctgtcttcatagtcagaagaactcagaagtattttgttggtttgtcgtgatacccagatatgccc |
38223057 |
T |
|
| Q |
112 |
accagttttatcagtggaaggatccaagcatccaatggattagagtttcatcaacactgaagttatctgcagctattatcatctacagtcaaggtgctga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38223058 |
accagttttatcagtggaaggatccaagcatccaatggattagagtttcatcaacactgaagttatctgcagctattatcatctacagtcaaggtgctga |
38223157 |
T |
|
| Q |
212 |
aaaacaactctatttcttccaagagccttttaccgcccatatgaatcccccaggaatccatatctaatgtgtctggtgacatcaagtcaatgagaaacca |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38223158 |
aaaacaactctatttcttccaagagccttttaccgtccatatgaatcccccaggaatccatatctaatgtgtctggtgacatcaagtcaatgagaaacca |
38223257 |
T |
|
| Q |
312 |
gcaaacatctccaagatcatatgatgtggcaaggaccttctttat |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38223258 |
gcaaacatctccaagatcatatgatgtggcaaggaccttctttat |
38223302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University