View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20278_high_16 (Length: 258)

Name: NF20278_high_16
Description: NF20278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20278_high_16
NF20278_high_16
[»] chr6 (1 HSPs)
chr6 (1-235)||(26877169-26877403)


Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 26877403 - 26877169
Alignment:
1 accggactcaacaatggcattgatttgttgacagcggtagtaatttgagaatataaaatatttgattgtgatcacaattgtcggtaacgtacatggacac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||    
26877403 accggactcaacaatggcattgatttgttgacagcggtagtaatttgagaatataaaatatttgattatgatcacaattgtaggtaacggacatggacac 26877304  T
101 atgtcgaacagcaaacacaacttcgatcatgctgcaaattaaacatccatcacagtaaattcagacaatattttgaactgcacaaacatcatccacttac 200  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
26877303 atgtcgaacaccaaacacaacttcgatcatgctgcaaattaaacatccatcacagtaaattcagacaatattttgaactgcacaaacatcattcacttac 26877204  T
201 agaatcacaaacatgcaatcttgagattgtggagt 235  Q
    |||||||||||||||||||||||||||||||||||    
26877203 agaatcacaaacatgcaatcttgagattgtggagt 26877169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University