View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20278_high_19 (Length: 240)
Name: NF20278_high_19
Description: NF20278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20278_high_19 |
 |  |
|
| [»] scaffold0057 (3 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0954 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 39)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 27328833 - 27329052
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaacataattaaatgcaaatcacaaatgtcagtgtcgtgacgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| || |||||| ||||| ||| |||||| |
|
|
| T |
27328833 |
gggaccccttcccgaaccctgcgtatgcgggagctttaatgcatcggattgcctttttaacataattaaatgtaa-tcacaagtgtcaatgttatgacgg |
27328931 |
T |
 |
| Q |
119 |
tgtctgacacgatatgtgtctgacacctagacatttcttcgattagaagtgtctgtgcaagcaaagtttatgctttcattatagaaattatcaaaattga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27328932 |
tgtctgacacgatatgtgtctgacacctagacatttcttcgattagaagtgtctgttcaagcaaagtttatgctttcattatagaaattatcaaaattga |
27329031 |
T |
 |
| Q |
219 |
ttttaattatccttaccaaac |
239 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
27329032 |
ttttaattatcctaaccaaac |
27329052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 38879662 - 38879721
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaa |
78 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
38879662 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttaa |
38879721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 16957393 - 16957451
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
16957393 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
16957451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 24448969 - 24449026
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
24448969 |
gggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgccctttt |
24449026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 61
Target Start/End: Complemental strand, 7097814 - 7097774
Alignment:
| Q |
21 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7097814 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgca |
7097774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 25622539 - 25622591
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
25622539 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcc |
25622591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 24 - 78
Target Start/End: Original strand, 32354211 - 32354265
Alignment:
| Q |
24 |
cccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaa |
78 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
32354211 |
cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttttaa |
32354265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 32703501 - 32703559
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
32703501 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
32703559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 39801595 - 39801653
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
39801595 |
gggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgccatttta |
39801653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 16028680 - 16028623
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
16028680 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
16028623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 43334284 - 43334340
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||| ||||||||| |||| |
|
|
| T |
43334284 |
gggaccccttcccggaccctgcg-atgcgggagctttagtgcaccgggttgccctttt |
43334340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 43574685 - 43574742
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||| |||| ||| ||||| |
|
|
| T |
43574685 |
gggaccccttcccggaccctgcgtatgcgggagctttagagcaccgggatgctttttt |
43574742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 34 - 70
Target Start/End: Original strand, 18684367 - 18684403
Alignment:
| Q |
34 |
accctgcgtatgcgggagctttagtgcatcgggttgc |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18684367 |
accctgcgtatgcgggagctttagtgcatcgggttgc |
18684403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 41014397 - 41014456
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaa |
78 |
Q |
| |
|
|||||||||||| | |||| || |||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
41014397 |
gggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgcccttttaa |
41014456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 4619160 - 4619102
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| |||| || |||||| ||||||||||||| ||||||||| ||||| |
|
|
| T |
4619160 |
gggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgccctttta |
4619102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 8170040 - 8169983
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| || |||||| ||||||||| |||| |
|
|
| T |
8170040 |
gggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgccctttt |
8169983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 10306530 - 10306493
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagcttta |
56 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10306530 |
gggaccccttcccggaccctgcgtatgcgggagcttta |
10306493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 5873378 - 5873326
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||| ||| |||| || |||||||||||||||||||||||||||||| |||| |
|
|
| T |
5873378 |
gggactcctccccggacactgcgtatgcgggagctttagtgcatcgggatgcc |
5873326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 7368475 - 7368527
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||| |||| ||||||| ||||||| ||||||||| |
|
|
| T |
7368475 |
gggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcc |
7368527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 12006384 - 12006332
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||| || |||||| |
|
|
| T |
12006384 |
gggaccccttcccagaccctgcctatgcgggagctttagtgcaccgtgttgcc |
12006332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 13801823 - 13801771
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||| || |||||| ||||||||||||| ||||||||| |
|
|
| T |
13801823 |
gggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgcc |
13801771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 21784388 - 21784336
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||| ||||||||| || |||||| |
|
|
| T |
21784388 |
gggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgcc |
21784336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 30006404 - 30006460
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttt |
75 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30006404 |
gggaccccttcccggggcctatgtatgcgggagctttagtgcaccgggttgcctttt |
30006460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 30877620 - 30877568
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||| |||| ||||||| ||||||| ||||||||| |
|
|
| T |
30877620 |
gggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcc |
30877568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 34154870 - 34154818
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||| ||||||| ||||||||| |
|
|
| T |
34154870 |
gggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcc |
34154818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 3771418 - 3771477
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaa |
78 |
Q |
| |
|
|||||||||||||| || ||| ||||| ||||||||||||||| |||| |||| |||||| |
|
|
| T |
3771418 |
gggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgcccttttaa |
3771477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 68
Target Start/End: Complemental strand, 16880701 - 16880654
Alignment:
| Q |
21 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggtt |
68 |
Q |
| |
|
|||| ||||||| ||| |||||||||||||||||||||||| |||||| |
|
|
| T |
16880701 |
gaccacttcccggaccatgcgtatgcgggagctttagtgcaccgggtt |
16880654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 4654471 - 4654429
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||| |||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
4654471 |
gggatcccttctcgaaccctgcatatgcgggagctttagtgca |
4654429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 66
Target Start/End: Original strand, 13774949 - 13774991
Alignment:
| Q |
24 |
cccttcccgaaccctgcgtatgcgggagctttagtgcatcggg |
66 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
13774949 |
ccctttccggaccctgcgtatgcgggagctttagtgcaccggg |
13774991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 19142999 - 19142957
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| ||||||||| |
|
|
| T |
19142999 |
gggaccccttcccggaccatgcgtatgcgggagatttagtgca |
19142957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 71
Target Start/End: Original strand, 22187368 - 22187418
Alignment:
| Q |
21 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||| |||||| | ||||| |||||||||||||||| ||||||| |
|
|
| T |
22187368 |
gaccccttcccaaaccctacatatgcaggagctttagtgcatcaggttgcc |
22187418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 22861725 - 22861683
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| ||||||| |
|
|
| T |
22861725 |
gggaccccttctcgaaccctgcatatgcgggagctctagtgca |
22861683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 85
Target Start/End: Original strand, 29334475 - 29334541
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaacataatt |
85 |
Q |
| |
|
||||||| |||||| |||||||||||| |||| ||||| |||| |||| |||| ||||||| ||||| |
|
|
| T |
29334475 |
gggacccattcccggaccctgcgtatgtgggatctttaatgcaccgggctgcccttttaacttaatt |
29334541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 10943900 - 10943844
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||| |||| |||| |||| |
|
|
| T |
10943900 |
gggaccccttcccggaccctgca-atgcgggagctttagtgcaccgggctgccctttt |
10943844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 71
Target Start/End: Complemental strand, 29184098 - 29184065
Alignment:
| Q |
38 |
tgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
29184098 |
tgcgtatgcgggagctttagtgcaccgggttgcc |
29184065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 35710390 - 35710447
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| | | ||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
35710390 |
gggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgccctttt |
35710447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 1565511 - 1565562
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||| |||| |||||| |||||||| ||||||||| |
|
|
| T |
1565511 |
gggaccccttcccggaccctgcatatgtgggagc-ttagtgcaccgggttgcc |
1565562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 12575716 - 12575664
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||| | ||||||||||||| |||||||| ||||| |||| |||| |
|
|
| T |
12575716 |
gggaccccttcctggaccctgcgtatgcaggagctttggtgcaccgggctgcc |
12575664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 20135685 - 20135737
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||| || ||||| ||||||| |||||| ||||||||| |
|
|
| T |
20135685 |
gggaccccttcccggaccccgcatatgcaggagcttcagtgcaccgggttgcc |
20135737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 9e-20; HSPs: 41)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 28817682 - 28817625
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28817682 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgccctttt |
28817625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 27507989 - 27508039
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttg |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27507989 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttg |
27508039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 20 - 76
Target Start/End: Original strand, 18595918 - 18595974
Alignment:
| Q |
20 |
ggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18595918 |
ggaccccttcccggaccctgtgtatgcgggagttttagtgcatcgggttgccttttt |
18595974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 21 - 77
Target Start/End: Complemental strand, 39461048 - 39460992
Alignment:
| Q |
21 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
39461048 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
39460992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 12625969 - 12626027
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
12625969 |
gggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
12626027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 35261758 - 35261815
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
35261758 |
gggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
35261815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 69
Target Start/End: Complemental strand, 20284125 - 20284075
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttg |
69 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
20284125 |
gggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
20284075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 69
Target Start/End: Complemental strand, 21070753 - 21070703
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttg |
69 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
21070753 |
gggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
21070703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 76
Target Start/End: Complemental strand, 27468141 - 27468091
Alignment:
| Q |
26 |
cttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
27468141 |
cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
27468091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 36720875 - 36720933
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||| | ||||||| ||||| |
|
|
| T |
36720875 |
gggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgccctttta |
36720933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 44530228 - 44530278
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttg |
69 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44530228 |
gggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttg |
44530278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 22 - 71
Target Start/End: Original strand, 17823658 - 17823707
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
17823658 |
accccttcccgaaccctgcatatgcaggagctttagtgcaccgggttgcc |
17823707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 76
Target Start/End: Complemental strand, 18164808 - 18164759
Alignment:
| Q |
27 |
ttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
18164808 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccatttt |
18164759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 25250603 - 25250660
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||||||||| || |||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
25250603 |
gggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgccctttt |
25250660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 26102596 - 26102653
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
26102596 |
gggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccctttt |
26102653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 30454153 - 30454096
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
30454153 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
30454096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 77
Target Start/End: Original strand, 31457252 - 31457309
Alignment:
| Q |
20 |
ggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||| ||| ||||| ||||| |
|
|
| T |
31457252 |
ggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgccctttta |
31457309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 13160780 - 13160832
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
13160780 |
gggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgcc |
13160832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 28407482 - 28407534
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |||| ||||||||| |
|
|
| T |
28407482 |
gggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcc |
28407534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 45071343 - 45071395
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||| |||||| ||||||||| |
|
|
| T |
45071343 |
gggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgcc |
45071395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 29877173 - 29877215
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
29877173 |
gggaccccttcccggaccctgcgtatgcgggagcgttagtgca |
29877215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 6760903 - 6760960
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||| || |||| || |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
6760903 |
gggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
6760960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 7136583 - 7136534
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggtt |
68 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||| |||||| |
|
|
| T |
7136583 |
gggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggtt |
7136534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 8897820 - 8897763
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||| |||| | ||||||| |||| |
|
|
| T |
8897820 |
gggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgccctttt |
8897763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 10857908 - 10857965
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||| ||||| | ||| |||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
10857908 |
gggaccacttcctggaccttgcgtatgcgggagctttagtgcaccgggttgccctttt |
10857965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 12670306 - 12670257
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggtt |
68 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
12670306 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggtt |
12670257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 77
Target Start/End: Original strand, 16013537 - 16013594
Alignment:
| Q |
21 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttg-ccttttta |
77 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
16013537 |
gaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtccttttta |
16013594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 20870004 - 20870061
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||| | |||| || |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
20870004 |
gggaccccttccaggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
20870061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 71
Target Start/End: Original strand, 33867038 - 33867083
Alignment:
| Q |
26 |
cttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
33867038 |
cttcccgaaccctgcgtatgcagaagctttagtgcaccgggttgcc |
33867083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 35107367 - 35107310
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| || ||| |||||||| |||||||||||| ||||||||| |||| |
|
|
| T |
35107367 |
gggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgccctttt |
35107310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 22 - 70
Target Start/End: Original strand, 5689713 - 5689761
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgc |
70 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||| ||| |||| |
|
|
| T |
5689713 |
accccttcccgaaccatgcgtatgtgggagctttagtgcaccggtttgc |
5689761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 17250931 - 17250880
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
17250931 |
gggaccctttcccgaaccctgcgtatgaaggagctttagtgca-cgggttgcc |
17250880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 70
Target Start/End: Complemental strand, 29521726 - 29521690
Alignment:
| Q |
34 |
accctgcgtatgcgggagctttagtgcatcgggttgc |
70 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29521726 |
accctgcgtatgcgggagctttagtgcaccgggttgc |
29521690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 42083754 - 42083702
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||||||||||||| ||| | |||||||||||||||| ||| |||| |
|
|
| T |
42083754 |
gggaccccttcccgaaccctgtgtacgtgggagctttagtgcattgggctgcc |
42083702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 16225100 - 16225150
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttg |
69 |
Q |
| |
|
|||| ||||||||| |||| || |||||||||||||||||||| ||||||| |
|
|
| T |
16225100 |
gggatcccttcccggaccccgcatatgcgggagctttagtgcaccgggttg |
16225150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 44781560 - 44781518
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
44781560 |
gggaccccgtcccagaccctgcgtatgcgggagctttagtgca |
44781518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 5135345 - 5135289
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| ||||| |||| |||| |||| |
|
|
| T |
5135345 |
gggaccccttcccggaccctgcgtatgcaggagcttt-gtgcaccgggctgccctttt |
5135289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 24245528 - 24245565
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagcttta |
56 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
24245528 |
gggaccccttcctggaccctgcgtatgcgggagcttta |
24245565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 24365115 - 24365079
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagcttt |
55 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
24365115 |
gggaccccttcccggaccctgcgtatgtgggagcttt |
24365079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 36486622 - 36486570
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||| ||||||| ||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
36486622 |
gggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgcc |
36486570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 61
Target Start/End: Original strand, 40444843 - 40444887
Alignment:
| Q |
17 |
cagggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
40444843 |
cagggaccccttgccggaccctgcgtatgttggagctttagtgca |
40444887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 46)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 13628846 - 13628788
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
13628846 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
13628788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 40272868 - 40272811
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
40272868 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
40272811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 54484792 - 54484849
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
54484792 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
54484849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 516513 - 516570
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
516513 |
gggaccccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
516570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 20 - 77
Target Start/End: Complemental strand, 10484671 - 10484614
Alignment:
| Q |
20 |
ggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
10484671 |
ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
10484614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 829498 - 829456
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
829498 |
gggaccccttcccgaaccctgcgtatgcaggagctttagtgca |
829456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 25517226 - 25517168
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| | ||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
25517226 |
gggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgccctttta |
25517168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 29366776 - 29366718
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
29366776 |
gggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgccctttta |
29366718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 30452896 - 30452954
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
30452896 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
30452954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 76
Target Start/End: Original strand, 40390353 - 40390399
Alignment:
| Q |
30 |
ccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
40390353 |
ccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
40390399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 1217189 - 1217246
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
1217189 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
1217246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 76
Target Start/End: Complemental strand, 5173771 - 5173718
Alignment:
| Q |
23 |
ccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
5173771 |
ccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgccctttt |
5173718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 13730658 - 13730601
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
13730658 |
gggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
13730601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 24851357 - 24851300
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| | ||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
24851357 |
gggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgccctttt |
24851300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 76
Target Start/End: Original strand, 47624208 - 47624257
Alignment:
| Q |
27 |
ttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
47624208 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
47624257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 52926275 - 52926218
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| ||| ||||||||| |||| |
|
|
| T |
52926275 |
gggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctttt |
52926218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 353405 - 353353
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
353405 |
gggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc |
353353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 22609866 - 22609918
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||| |||||| ||||||||| |
|
|
| T |
22609866 |
gggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgcc |
22609918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 39203615 - 39203667
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
39203615 |
gggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgcc |
39203667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 45786270 - 45786218
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
45786270 |
gggaccccttcccggaccctgcgaatgctggagctttagtgcaccgggttgcc |
45786218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 24 - 71
Target Start/End: Complemental strand, 14266423 - 14266376
Alignment:
| Q |
24 |
cccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14266423 |
cccttcctgaaccctgcgtatgcgggagctttagtgcactgggttgcc |
14266376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 77
Target Start/End: Complemental strand, 54032612 - 54032569
Alignment:
| Q |
34 |
accctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
54032612 |
accctgcgtatgcgggagctttagtgcaccgggttgccctttta |
54032569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 34 - 76
Target Start/End: Complemental strand, 4495717 - 4495675
Alignment:
| Q |
34 |
accctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
4495717 |
accctgcgtatgcgggagctttagtgcaccgggttgccctttt |
4495675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 45948894 - 45948852
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
45948894 |
gggaccccttctcggaccctgcgtatgcgggagctttagtgca |
45948852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 46421091 - 46421033
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagcttt-agtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||| ||| ||||| |||| |
|
|
| T |
46421091 |
gggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttgccctttt |
46421033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 15797321 - 15797378
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||| ||||||| ||||||| ||||||||| |||| |
|
|
| T |
15797321 |
gggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccctttt |
15797378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 26869807 - 26869864
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||| ||| ||| |||||||||||||||||| ||||| ||||||||| |||| |
|
|
| T |
26869807 |
gggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgccctttt |
26869864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 34771420 - 34771363
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| |||| |||| |||| |
|
|
| T |
34771420 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgccctttt |
34771363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 44403611 - 44403554
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||| ||||||| | |||||||||||| |||| ||||||||| |
|
|
| T |
44403611 |
gggaccccttcccggaccctacgtatgctgaagctttagtgcaccgggctgccttttt |
44403554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 49013529 - 49013472
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||| || || ||||||||||||||||| ||||||||| |||| |
|
|
| T |
49013529 |
gggaccccttcccggaccccgcatacgcgggagctttagtgcaccgggttgccctttt |
49013472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 10795479 - 10795427
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||| |||||| | ||||||| |
|
|
| T |
10795479 |
gggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccaggttgcc |
10795427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 22122973 - 22122921
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||| |||||| ||||| ||||||| ||||||||| |
|
|
| T |
22122973 |
gggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgcc |
22122921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 31592948 - 31593000
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||| |||||||| ||||||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
31592948 |
gggactccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
31593000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 26292431 - 26292490
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttg-ccttttta |
77 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||| || ||||||| ||||||| |||||||| |
|
|
| T |
26292431 |
gggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggttgtccttttta |
26292490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 74
Target Start/End: Complemental strand, 43114908 - 43114869
Alignment:
| Q |
35 |
ccctgcgtatgcgggagctttagtgcatcgggttgccttt |
74 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
43114908 |
ccctgcgtatgcgggagctttagtgcattggattgccttt |
43114869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 58
Target Start/End: Complemental strand, 54374401 - 54374362
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagt |
58 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
54374401 |
gggaccccttcccggaccctgcatatgcgggagctttagt |
54374362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 6411878 - 6411836
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
6411878 |
gggaccccttcccagaccttgcgtatgcgggagctttagtgca |
6411836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 76
Target Start/End: Original strand, 7943110 - 7943148
Alignment:
| Q |
38 |
tgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7943110 |
tgcgtatgcgggagctttagtgcactgggttgccttttt |
7943148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 16735541 - 16735599
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||| |||||| |||||||| ||||| |
|
|
| T |
16735541 |
gggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgccctttta |
16735599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 26573228 - 26573270
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||| ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
26573228 |
gggaccccatcccggaccctgcgtatgcgtgagctttagtgca |
26573270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 34420699 - 34420657
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||||||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
34420699 |
gggaccccttcccggaccttgcgtatgtgggagctttagtgca |
34420657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 8247743 - 8247706
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagcttta |
56 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
8247743 |
gggactccttcccggaccctgcgtatgcgggagcttta |
8247706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 14987060 - 14987109
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggtt |
68 |
Q |
| |
|
||||||| |||||| ||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
14987060 |
gggacccattcccggaccttgcatatgcgggagctttagtgcaccgggtt |
14987109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 53996621 - 53996564
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||| || ||||||||| ||||||||||||||| |||| |||| |||| |
|
|
| T |
53996621 |
gggaccccttccctgacactgcgtatgtgggagctttagtgcaccgggctgccctttt |
53996564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 77
Target Start/End: Complemental strand, 12914089 - 12914033
Alignment:
| Q |
21 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||| | |||| ||||||||| ||||| |
|
|
| T |
12914089 |
gaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgccctttta |
12914033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 35418005 - 35418057
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||| || ||||| |||||||||||||||||| |||| |
|
|
| T |
35418005 |
gggaccccttcccggaccccgcaaatgcgagagctttagtgcatcgggctgcc |
35418057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 47)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 9671258 - 9671316
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
9671258 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
9671316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 10546242 - 10546299
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
10546242 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
10546299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 10543779 - 10543831
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10543779 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
10543831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 14530399 - 14530451
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14530399 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
14530451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 8455372 - 8455314
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
8455372 |
gggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgccctttta |
8455314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 39914361 - 39914304
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39914361 |
gggaccccttcctga-ccctgcgtatgcgggagctttagtgcatcgggttgccctttta |
39914304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 14444807 - 14444864
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| | ||||||| |||| |
|
|
| T |
14444807 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccctttt |
14444864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 25249794 - 25249737
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||| ||||||||| |||| |
|
|
| T |
25249794 |
gggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgccctttt |
25249737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 34766334 - 34766383
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggtt |
68 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
34766334 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtt |
34766383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 75
Target Start/End: Complemental strand, 124962 - 124914
Alignment:
| Q |
27 |
ttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttt |
75 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
124962 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcctttt |
124914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 40579805 - 40579753
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
40579805 |
gggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgcc |
40579753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 23488562 - 23488613
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgc |
70 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
23488562 |
gggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgc |
23488613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 21779317 - 21779259
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
21779317 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
21779259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 27 - 77
Target Start/End: Original strand, 22371199 - 22371249
Alignment:
| Q |
27 |
ttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
22371199 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
22371249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 22 - 76
Target Start/End: Complemental strand, 24860041 - 24859987
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
24860041 |
accccttctcggaccctgcgtatgcgggagctttagtgcaccggattgccttttt |
24859987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 34080180 - 34080238
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
34080180 |
gggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgccctttta |
34080238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 17896339 - 17896396
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||| || |||||||||||| |||||||||||||||||| |||||| |||| |
|
|
| T |
17896339 |
gggaccccttctcggaccctgcgtatgtgggagctttagtgcatcgagttgccctttt |
17896396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 19615073 - 19615114
Alignment:
| Q |
20 |
ggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19615073 |
ggaccccttcccgaaccctgcgtatgcaggagctttagtgca |
19615114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 36871571 - 36871627
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
36871571 |
gggaccccttcccggacc-tgcgtatgcgggagctttagtgcaccgggttgccctttt |
36871627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 25079773 - 25079721
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
25079773 |
gggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgcc |
25079721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 41409941 - 41409993
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
41409941 |
gggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgcc |
41409993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 71
Target Start/End: Original strand, 8575975 - 8576026
Alignment:
| Q |
20 |
ggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||| | ||||||| |
|
|
| T |
8575975 |
ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgcc |
8576026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 26684676 - 26684617
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttg-ccttttta |
77 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||| ||| ||| |||||||| |
|
|
| T |
26684676 |
gggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggattgtccttttta |
26684617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 44643602 - 44643661
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaa |
78 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||| |||| |||| |||||| |
|
|
| T |
44643602 |
gggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgcccttttaa |
44643661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 5841109 - 5841167
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||| || |||||| ||||| |
|
|
| T |
5841109 |
gggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctttta |
5841167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 22 - 76
Target Start/End: Original strand, 17668084 - 17668138
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
17668084 |
accccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgccctttt |
17668138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 24890490 - 24890532
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
24890490 |
gggaccccttcccggaccctgcgtatgcaggagctttagtgca |
24890532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 71
Target Start/End: Original strand, 25632594 - 25632640
Alignment:
| Q |
25 |
ccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
25632594 |
ccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgcc |
25632640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 77
Target Start/End: Original strand, 11514519 - 11514572
Alignment:
| Q |
24 |
cccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||| ||||| ||||| |
|
|
| T |
11514519 |
cccttcccagaccctgcgtatgcgggagctttagtgcaccggattgccctttta |
11514572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 14544146 - 14544187
Alignment:
| Q |
20 |
ggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
14544146 |
ggaccccttccgggaccctgcgtatgcgggagctttagtgca |
14544187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 76
Target Start/End: Original strand, 27573707 - 27573756
Alignment:
| Q |
27 |
ttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||| ||||||| ||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
27573707 |
ttcccaaaccctgtgtatgtgggagctttagtgcatcgggttgccctttt |
27573756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 13245151 - 13245099
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||| ||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
13245151 |
gggaccccttcccggaccatgcatatacgggagctttagtgtatcgggttgcc |
13245099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 21377129 - 21377093
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagcttt |
55 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21377129 |
gggaccccttcccgaaccctgcgtatgtgggagcttt |
21377093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 25641580 - 25641620
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtg |
59 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
25641580 |
gggaccccttcccgaatcctgcgtatgcgagagctttagtg |
25641620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 76
Target Start/End: Complemental strand, 39189555 - 39189503
Alignment:
| Q |
24 |
cccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||| |||| || |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
39189555 |
cccttcccggaccccgcatatgcgggagctctagtgcaccgggttgccttttt |
39189503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 40762290 - 40762238
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||| |||| | |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
40762290 |
gggaccctttcctggaccctgcgtatgtgggagctttagtgcaccgggttgcc |
40762238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 58
Target Start/End: Complemental strand, 31158495 - 31158456
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagt |
58 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31158495 |
gggaccccttcccagaccctgcgtatgcgggagctttagt |
31158456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 71
Target Start/End: Complemental strand, 3633762 - 3633712
Alignment:
| Q |
21 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||| |||| || |||||||||||||||||||| || |||||| |
|
|
| T |
3633762 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcc |
3633712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 76
Target Start/End: Original strand, 17623646 - 17623700
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||| |||||||||| || |||||||||||| |||||||| |||| |
|
|
| T |
17623646 |
accccttcccgaatcctgcgtatgtggaagctttagtgcactgggttgccctttt |
17623700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 64
Target Start/End: Complemental strand, 19185796 - 19185754
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcg |
64 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||| ||||| |
|
|
| T |
19185796 |
accccttcctggaccctgcgtatgcgggagctttagtacatcg |
19185754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 19977770 - 19977728
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||| ||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
19977770 |
gggatcccttcccgaaccttgtgtatgcgggagctttagtgca |
19977728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 63
Target Start/End: Complemental strand, 22363549 - 22363507
Alignment:
| Q |
21 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgcatc |
63 |
Q |
| |
|
||||| ||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
22363549 |
gaccctttctcgaaccctgcgtacgcgggagctttagtgcatc |
22363507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 24200679 - 24200622
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||| ||||||||| |||||| ||||| | ||||||||||||| ||||||||| |||| |
|
|
| T |
24200679 |
gggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgccctttt |
24200622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 4516407 - 4516367
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtg |
59 |
Q |
| |
|
|||||||||||||| |||||||||||| || |||||||||| |
|
|
| T |
4516407 |
gggaccccttcccggaccctgcgtatgtggaagctttagtg |
4516367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 23397843 - 23397895
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||| || ||||| | |||||||||||| ||||||| ||||||||| |
|
|
| T |
23397843 |
gggaccccttctcggaccctacatatgcgggagctctagtgcaccgggttgcc |
23397895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 24059052 - 24059012
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtg |
59 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
24059052 |
gggacccctttccggaccctgcgtatgtgggagctttagtg |
24059012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 75
Target Start/End: Complemental strand, 31821399 - 31821343
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttt |
75 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||| |||| | || |||||||| |
|
|
| T |
31821399 |
gggacccctttccgaaacctgtgtatgcgggagctttaatgcacctggctgcctttt |
31821343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 46; Significance: 2e-17; HSPs: 3)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 24828 - 24771
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||| |
|
|
| T |
24828 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcagccggttgccctttt |
24771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 46910 - 46967
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
46910 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
46967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 46763 - 46719
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatc |
63 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
46763 |
gggaccccttcccagaccctgcgtatgcgggagctttaatgcatc |
46719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 25)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 29355911 - 29355854
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
29355911 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
29355854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 6808474 - 6808531
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
6808474 |
gggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttt |
6808531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 1354813 - 1354754
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaa |
78 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
1354813 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttaa |
1354754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 12885992 - 12886051
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaa |
78 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||| ||||||||| |||||| |
|
|
| T |
12885992 |
gggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgcccttttaa |
12886051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 12221971 - 12221913
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagc-tttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
12221971 |
gggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctttt |
12221913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 26097236 - 26097294
Alignment:
| Q |
18 |
agggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
26097236 |
agggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
26097294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 22 - 76
Target Start/End: Complemental strand, 30786427 - 30786373
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||| | ||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30786427 |
accccttcctggaccgtgcgtatgcgggagctttagtgcaccgggttgccttttt |
30786373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 1347041 - 1347098
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
1347041 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
1347098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 12892088 - 12892145
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
12892088 |
gggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
12892145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 13267804 - 13267861
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||| |||||| ||||||||| |||| |
|
|
| T |
13267804 |
gggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgccctttt |
13267861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 14975146 - 14975094
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||||||||||| || |||||||||| ||||||||| ||||||||| |
|
|
| T |
14975146 |
gggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgcc |
14975094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 23930183 - 23930125
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||||||||||| || |||||| ||||| |
|
|
| T |
23930183 |
gggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgccctttta |
23930125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 22 - 76
Target Start/End: Original strand, 25557805 - 25557859
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
25557805 |
accccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
25557859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 3815133 - 3815084
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggtt |
68 |
Q |
| |
|
||||||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
3815133 |
gggaccctttcccgaaccctacgtatgcggaagctttagtgcaccgggtt |
3815084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 9161203 - 9161260
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||| || ||||||||||||||| |||||||||||| | ||||||| |||| |
|
|
| T |
9161203 |
gggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggttgccctttt |
9161260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 71
Target Start/End: Complemental strand, 10734957 - 10734909
Alignment:
| Q |
23 |
ccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| || |||| |||| |
|
|
| T |
10734957 |
ccccttcccggaccctgcgtatgcgggagctttagtccaccgggctgcc |
10734909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 24097656 - 24097696
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtg |
59 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
24097656 |
gggaccccttcccggaccctgcgtatgcggaagctttagtg |
24097696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 58
Target Start/End: Original strand, 11395840 - 11395879
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagt |
58 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
11395840 |
gggaccccttcccggatcctgcgtatgcgggagctttagt |
11395879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 22 - 69
Target Start/End: Original strand, 34850618 - 34850665
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttg |
69 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
34850618 |
accccttcccgaatcctgcgtatataggagctttagtgcatcgggttg |
34850665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 2166466 - 2166409
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||||||||| ||||||||| |||| |
|
|
| T |
2166466 |
gggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctttt |
2166409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 2178099 - 2178042
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||||||||| ||||||||| |||| |
|
|
| T |
2178099 |
gggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctttt |
2178042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 3116185 - 3116128
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||| || ||| ||||||||||||||||||||| || ||| ||||| |||| |
|
|
| T |
3116185 |
gggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgccctttt |
3116128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 383816 - 383764
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
383816 |
gggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgcc |
383764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 76
Target Start/End: Complemental strand, 9671139 - 9671083
Alignment:
| Q |
20 |
ggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||| ||||||||||| || ||||||||||| ||||||||| |||| |||| |
|
|
| T |
9671139 |
ggacccctttccgaaccctgcaaatacgggagctttaatgcatcgggctgccctttt |
9671083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 29016337 - 29016301
Alignment:
| Q |
20 |
ggaccccttcccgaaccctgcgtatgcgggagcttta |
56 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29016337 |
ggaccccttcccagaccctgcgtatgcgggagcttta |
29016301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 58)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 7909337 - 7909284
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgc-gggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7909337 |
gggaccccttcccgaaccctgcgtatgcggggagctttagtgcatcgggttgcc |
7909284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 20639714 - 20639657
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
20639714 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
20639657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 33836543 - 33836486
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
33836543 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctttt |
33836486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 38755964 - 38755912
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38755964 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
38755912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 44363186 - 44363134
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44363186 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
44363134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 20908692 - 20908650
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20908692 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
20908650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 21 - 71
Target Start/End: Complemental strand, 40553991 - 40553941
Alignment:
| Q |
21 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40553991 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
40553941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 23501868 - 23501925
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
23501868 |
gggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
23501925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 32484312 - 32484369
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
32484312 |
gggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
32484369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 35567249 - 35567306
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||| |||| |||| |
|
|
| T |
35567249 |
gggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgccctttt |
35567306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 11394931 - 11394983
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11394931 |
gggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
11394983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 11404658 - 11404710
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11404658 |
gggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
11404710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 21489167 - 21489218
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgc |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
21489167 |
gggaccccttcccgaaccctgcgtatgcgggagctttcgtgcactgggttgc |
21489218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 25 - 76
Target Start/End: Original strand, 35532077 - 35532128
Alignment:
| Q |
25 |
ccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
35532077 |
ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
35532128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 30690232 - 30690190
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30690232 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgca |
30690190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 5648337 - 5648394
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||| |||||||| |||| |
|
|
| T |
5648337 |
gggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgccctttt |
5648394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 13256455 - 13256398
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||||| ||||||||| |||| |
|
|
| T |
13256455 |
gggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgccctttt |
13256398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 25629128 - 25629185
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||| | |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
25629128 |
gggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttgccctttt |
25629185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 30352636 - 30352579
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||| || |||||| |||| |
|
|
| T |
30352636 |
gggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgccctttt |
30352579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 38786688 - 38786745
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
38786688 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
38786745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 6430682 - 6430630
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
6430682 |
gggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcc |
6430630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 14983913 - 14983953
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtg |
59 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14983913 |
gggaccccttcccggaccctgcgtatgcgggagctttagtg |
14983953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 20225061 - 20225113
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
20225061 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
20225113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 20225155 - 20225207
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
20225155 |
gggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc |
20225207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 20405168 - 20405220
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||||||||||||| |||||||| |
|
|
| T |
20405168 |
gggaccccttcccggaccccgcatatgcgggagctttagtgcattgggttgcc |
20405220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 25388255 - 25388307
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
25388255 |
gggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgcc |
25388307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 29207954 - 29207902
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
29207954 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
29207902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 76
Target Start/End: Original strand, 30639460 - 30639515
Alignment:
| Q |
21 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||| |||||||| |||| |
|
|
| T |
30639460 |
gaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgccctttt |
30639515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 54
Target Start/End: Original strand, 49796876 - 49796911
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctt |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
49796876 |
gggaccccttcccgaaccctgcgtatgcgggagctt |
49796911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 61
Target Start/End: Original strand, 54730334 - 54730373
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
54730334 |
accccttcccggaccctgcgtatgcgggagctttagtgca |
54730373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 22 - 76
Target Start/End: Complemental strand, 11054201 - 11054147
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
11054201 |
accccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
11054147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 22 - 76
Target Start/End: Complemental strand, 16408654 - 16408600
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||| |||| || |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
16408654 |
accccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
16408600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 16911643 - 16911701
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||| | ||||||||| ||||| |
|
|
| T |
16911643 |
gggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgccctttta |
16911701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 47482906 - 47482864
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
47482906 |
gggaccccttcccggaccctgcgtatgcgggagctttggtgca |
47482864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 21647045 - 21647097
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
21647045 |
gggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
21647097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 40915907 - 40915959
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||| |||||| ||| ||||| |
|
|
| T |
40915907 |
gggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgcc |
40915959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 44718646 - 44718698
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| || ||||||||| |
|
|
| T |
44718646 |
gggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgcc |
44718698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 8473678 - 8473624
Alignment:
| Q |
19 |
gggaccccttccc--gaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||||| || |||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
8473678 |
gggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgcc |
8473624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 61
Target Start/End: Complemental strand, 37038172 - 37038137
Alignment:
| Q |
26 |
cttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37038172 |
cttcccgtaccctgcgtatgcgggagctttagtgca |
37038137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 78
Target Start/End: Complemental strand, 51865090 - 51865035
Alignment:
| Q |
23 |
ccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaa |
78 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||| ||| |||| |||||| |
|
|
| T |
51865090 |
ccccttcccggaccctgcgtatgcgggagctttattgcaccggactgcccttttaa |
51865035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 76
Target Start/End: Complemental strand, 39077837 - 39077795
Alignment:
| Q |
34 |
accctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
39077837 |
accctgcatatgcgggagctctagtgcaccgggttgccttttt |
39077795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 76
Target Start/End: Complemental strand, 50555709 - 50555655
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||| ||||||||||||| |||| ||||||||| |||| |||| |||| |
|
|
| T |
50555709 |
accccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgccctttt |
50555655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 54175143 - 54175201
Alignment:
| Q |
19 |
gggaccccttccc-gaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||| | ||||||| |||||||||||||||||||| |||| |||| |||| |
|
|
| T |
54175143 |
gggaccccttccccggaccctgcatatgcgggagctttagtgcaccgggctgccctttt |
54175201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 9832369 - 9832312
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||| || ||||||| ||||||||| |||| |
|
|
| T |
9832369 |
gggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggttgccctttt |
9832312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 28494230 - 28494287
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||| | ||||| |||||||||||| ||||||| |||| ||||||||| |
|
|
| T |
28494230 |
gggaccccttcccagatcctgcatatgcgggagctctagtgcaccgggctgccttttt |
28494287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 36816440 - 36816383
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||| |||||| | |||||| ||||||||||||||||||| | ||||||||| |||| |
|
|
| T |
36816440 |
gggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgccctttt |
36816383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 47444036 - 47444093
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||||||| |||||| |||||||| |||| |
|
|
| T |
47444036 |
gggaccccttcccggaccctgcatatgcaggagcttcagtgcactgggttgccctttt |
47444093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 47528586 - 47528529
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||| |||| ||||||| ||||||| ||||||||| |||| |
|
|
| T |
47528586 |
gggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgccctttt |
47528529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 62
Target Start/End: Original strand, 48202395 - 48202432
Alignment:
| Q |
25 |
ccttcccgaaccctgcgtatgcgggagctttagtgcat |
62 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
48202395 |
ccttaccgaaccccgcgtatgcgggagctttagtgcat |
48202432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 48598881 - 48598824
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||| ||| ||||| |||||| ||||||| ||||||||| |||| |
|
|
| T |
48598881 |
gggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgccctttt |
48598824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 5306720 - 5306659
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatg----cgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||| |||| ||||||||| |||| |
|
|
| T |
5306720 |
gggaccccttcccggaccctgcgtatgtggacgggagctttaatgcaccgggttgccctttt |
5306659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 8820587 - 8820631
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatc |
63 |
Q |
| |
|
||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
8820587 |
gggaccccttcccagaccctgcgtatgcgagagttttagtgcatc |
8820631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 71
Target Start/End: Original strand, 10660501 - 10660537
Alignment:
| Q |
36 |
cctgcgtatgcgggagcttt-agtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10660501 |
cctgcgtatgcgggagctttaagtgcatcgggttgcc |
10660537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 71
Target Start/End: Original strand, 10874646 - 10874682
Alignment:
| Q |
36 |
cctgcgtatgcgggagcttt-agtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10874646 |
cctgcgtatgcgggagctttaagtgcatcgggttgcc |
10874682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 25463201 - 25463237
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagcttt |
55 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
25463201 |
gggaccccttcccggaccctgcatatgcgggagcttt |
25463237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 32478847 - 32478811
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagcttt |
55 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
32478847 |
gggaccccttcccggacccagcgtatgcgggagcttt |
32478811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 36589823 - 36589875
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||| ||||| |||| |||| |
|
|
| T |
36589823 |
gggaccccttcctgaaccctatgtatgcgggagctttggtgcaccgggctgcc |
36589875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 76
Target Start/End: Original strand, 56322984 - 56323036
Alignment:
| Q |
24 |
cccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||| |||| | |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
56322984 |
cccttcccggaccccggatatgcgggagctttagtgcaccgggttgccctttt |
56323036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 45)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 4349740 - 4349792
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4349740 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
4349792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 35005227 - 35005286
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaa |
78 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||| ||||||||| |||||| |
|
|
| T |
35005227 |
gggaccccttcccggaccctgcgtatgcgggcgctttagtgcaccgggttgcccttttaa |
35005286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 10668329 - 10668387
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
10668329 |
gggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
10668387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 27474382 - 27474440
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||| ||||| ||||| |
|
|
| T |
27474382 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctttta |
27474440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 6925202 - 6925259
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
6925202 |
gggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgagttgccttttt |
6925259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 19414539 - 19414600
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaaca |
80 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
19414539 |
gggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgcccttttaaca |
19414600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 27201751 - 27201808
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
27201751 |
gggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggttgccctttt |
27201808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 45812593 - 45812536
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
45812593 |
gggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgccttttt |
45812536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 46248009 - 46247952
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| | ||||||||| |||| |
|
|
| T |
46248009 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgccctttt |
46247952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 50606505 - 50606562
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
50606505 |
gggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
50606562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 45402198 - 45402250
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45402198 |
gggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgcc |
45402250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 46991906 - 46991958
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
46991906 |
gggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgcc |
46991958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 18944747 - 18944805
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagc-tttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
18944747 |
gggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctttt |
18944805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 34725154 - 34725096
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
34725154 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
34725096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 42304263 - 42304206
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||| ||| ||||| |||| |
|
|
| T |
42304263 |
gggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgccctttt |
42304206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 15505666 - 15505702
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagcttt |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15505666 |
gggaccccttcccgaaccctgcgtatgcgggagcttt |
15505702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 21 - 61
Target Start/End: Complemental strand, 25554796 - 25554756
Alignment:
| Q |
21 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25554796 |
gaccccttcccgaaccctgcgtatgcgggagcattagtgca |
25554756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 70
Target Start/End: Complemental strand, 4587619 - 4587568
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgc |
70 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||| |||||| |||||||| |
|
|
| T |
4587619 |
gggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc |
4587568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 23 - 78
Target Start/End: Original strand, 9939570 - 9939625
Alignment:
| Q |
23 |
ccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaa |
78 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||| |||||| || |||||| |
|
|
| T |
9939570 |
ccccttctcggaccctgcgtatgcgggagctttagtgcaccgggttacccttttaa |
9939625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 14617140 - 14617199
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaa |
78 |
Q |
| |
|
|||| ||||||||| ||||||| |||||||||||||||||||| |||||| || |||||| |
|
|
| T |
14617140 |
gggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggttacccttttaa |
14617199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 23 - 61
Target Start/End: Original strand, 19701677 - 19701715
Alignment:
| Q |
23 |
ccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19701677 |
ccccttcccggaccctgcgtatgcgggagctttagtgca |
19701715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 20004146 - 20004088
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
20004146 |
gggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttta |
20004088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 30395782 - 30395724
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||| || |||||| ||||| |
|
|
| T |
30395782 |
gggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctttta |
30395724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 33594187 - 33594145
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33594187 |
gggaccccttcccagaccctgcgtatgcgggagctttagtgca |
33594145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 1517367 - 1517310
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||| | ||||||||||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
1517367 |
gggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgccctttt |
1517310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 18742013 - 18741964
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggtt |
68 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||| |||||| |
|
|
| T |
18742013 |
gggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtt |
18741964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 35253243 - 35253186
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||| ||||| |||| |
|
|
| T |
35253243 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctttt |
35253186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 76
Target Start/End: Complemental strand, 50760287 - 50760239
Alignment:
| Q |
28 |
tcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||| |||| |||| |
|
|
| T |
50760287 |
tcccgaaccctgcgtatgcgggagctttaatgcaccgggctgccctttt |
50760239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 70
Target Start/End: Complemental strand, 23768376 - 23768325
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgc |
70 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
23768376 |
gggacaccttcccagaccctgcgtatgcgggagctttagtgcagcggattgc |
23768325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 30555217 - 30555264
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcggg |
66 |
Q |
| |
|
||||||||||| || |||||||||||||| ||||||||||||| |||| |
|
|
| T |
30555217 |
gggaccccttcacggaccctgcgtatgcgagagctttagtgcaccggg |
30555264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 12126893 - 12126851
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| |
|
|
| T |
12126893 |
gggaccccttcccggaccctgcatatgcgggagctgtagtgca |
12126851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 77
Target Start/End: Complemental strand, 20999902 - 20999848
Alignment:
| Q |
23 |
ccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||| | |||||||||| ||||||||||||||||| |||| |||| ||||| |
|
|
| T |
20999902 |
ccccttccggcaccctgcgtacgcgggagctttagtgcaccgggctgccctttta |
20999848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 32632613 - 32632571
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||| |||||| |
|
|
| T |
32632613 |
gggaccccttcccaaaccctgcatatgcgggagcttgagtgca |
32632571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 76
Target Start/End: Complemental strand, 38478335 - 38478281
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||| || ||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
38478335 |
accccttctcggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
38478281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 41319862 - 41319804
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| || |||||| |||||||| ||||| |
|
|
| T |
41319862 |
gggaccccttcccgaacccttcatatgcgggagtttcagtgcactgggttgccctttta |
41319804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 76
Target Start/End: Original strand, 22327206 - 22327255
Alignment:
| Q |
27 |
ttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||| ||| ||||||||||||||| ||||| |||| ||||||||| |
|
|
| T |
22327206 |
ttcccgaactctgtgtatgcgggagctttggtgcaccgggctgccttttt |
22327255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 31382270 - 31382213
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||| | ||||||| ||||||||||||||| || | ||||||||| |||| |
|
|
| T |
31382270 |
gggaccccttcctggaccctgcatatgcgggagctttactgtaccgggttgccctttt |
31382213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 43768241 - 43768298
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| |||| |||| |||| |||| |
|
|
| T |
43768241 |
gggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgccctttt |
43768298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 50812043 - 50812084
Alignment:
| Q |
20 |
ggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
50812043 |
ggaccccttcccgcgccctgcgtatgcgggagctttaatgca |
50812084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 76
Target Start/End: Original strand, 8197146 - 8197202
Alignment:
| Q |
20 |
ggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||| || |||||||||||| |||||||||||| | ||||||||| |||| |
|
|
| T |
8197146 |
ggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggttgccctttt |
8197202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 10378791 - 10378739
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||| | ||||||| |||||||||||||||||||| |||| |||| |
|
|
| T |
10378791 |
gggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgcc |
10378739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 11596614 - 11596650
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagcttt |
55 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| |
|
|
| T |
11596614 |
gggaccccttcctggaccctgcgtatgcgggagcttt |
11596650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 30682914 - 30682950
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagcttt |
55 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
30682914 |
gggaccccttcccggaccgtgcgtatgcgggagcttt |
30682950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 66
Target Start/End: Complemental strand, 35117822 - 35117774
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgt-atgcgggagctttagtgcatcggg |
66 |
Q |
| |
|
|||||||||||||| ||||||||| |||| |||||||||||||| |||| |
|
|
| T |
35117822 |
gggaccccttcccggaccctgcgtaatgcaggagctttagtgcaccggg |
35117774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 71
Target Start/End: Complemental strand, 39215010 - 39214962
Alignment:
| Q |
23 |
ccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||| ||||||||||||| || |||||||||||| |||| |||| |
|
|
| T |
39215010 |
ccccttcccaaaccctgcgtatgtggaagctttagtgcaccgggctgcc |
39214962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 38)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 7879717 - 7879774
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||| ||||||||| |||| |
|
|
| T |
7879717 |
gggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttgccctttt |
7879774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 34626264 - 34626207
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
34626264 |
gggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgccctttt |
34626207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 38262252 - 38262195
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| ||| ||||| |||| |
|
|
| T |
38262252 |
gggaccccttcccgaacactgcgtatgcgggagctttagtgcaccggattgccctttt |
38262195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 18747566 - 18747618
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
18747566 |
gggaccccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgcc |
18747618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 76
Target Start/End: Original strand, 21566516 - 21566572
Alignment:
| Q |
20 |
ggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||| | ||||||| |
|
|
| T |
21566516 |
ggaccccttcccgaaccctgcatatgcgggagctttagtgcaccgggctaccttttt |
21566572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 21172065 - 21172006
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaa |
78 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
21172065 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttaa |
21172006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 23231636 - 23231678
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23231636 |
gggaccccttcccgaaccctgcgtatgcggcagctttagtgca |
23231678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 2541075 - 2541026
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggtt |
68 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
2541075 |
gggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggtt |
2541026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 27889372 - 27889315
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| || || ||||||||| |||| |
|
|
| T |
27889372 |
gggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgccctttt |
27889315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 32758338 - 32758395
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
32758338 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
32758395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 35334872 - 35334823
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggtt |
68 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||| |||||| |
|
|
| T |
35334872 |
gggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtt |
35334823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 42391156 - 42391099
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
42391156 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
42391099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 42798748 - 42798805
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||| |||||| ||||||| |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
42798748 |
gggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgccctttt |
42798805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 42805605 - 42805662
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
42805605 |
gggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
42805662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 22 - 71
Target Start/End: Complemental strand, 45018976 - 45018927
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
45018976 |
accccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgcc |
45018927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 18512509 - 18512457
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
18512509 |
gggaccccttcccggaccctgcgtatgcgggagctttggtgcactgggttgcc |
18512457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 48735178 - 48735126
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
48735178 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
48735126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 40463955 - 40464014
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttttaa |
78 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||| |||||| || |||||| |||||| |
|
|
| T |
40463955 |
gggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgcccttttaa |
40464014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 31591165 - 31591107
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| ||| ||| |||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
31591165 |
gggaccccttcccggaccttgcatatgcgggagctctagtgcaccgggttgccctttta |
31591107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 35787325 - 35787267
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||| | |||| ||||||||| ||||| |
|
|
| T |
35787325 |
gggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgggttgccctttta |
35787267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 34 - 76
Target Start/End: Original strand, 36602541 - 36602583
Alignment:
| Q |
34 |
accctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
36602541 |
accctgcgtatgcgggagctttagtgcaccgggttgccctttt |
36602583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 61
Target Start/End: Complemental strand, 42495913 - 42495876
Alignment:
| Q |
24 |
cccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42495913 |
cccttcccggaccctgcgtatgcgggagctttagtgca |
42495876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 47077911 - 47077854
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||| |||||| | |||||||||||| ||||||| ||| |||||||||| |
|
|
| T |
47077911 |
gggaccccttcccaaaccctacatatgcgggagctctagtgcaccggattgccttttt |
47077854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 10693129 - 10693077
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| |||||||| |
|
|
| T |
10693129 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgcc |
10693077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 11617644 - 11617592
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||| | ||||||||||||| ||| |||||||||| ||||||||| |
|
|
| T |
11617644 |
gggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgcc |
11617592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 75
Target Start/End: Complemental strand, 33871966 - 33871910
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttt |
75 |
Q |
| |
|
||||||||||||| |||||| ||||||| ||||||||||||| | ||||||||||| |
|
|
| T |
33871966 |
gggaccccttcccagaccctgtgtatgcgagagctttagtgcaccaggttgcctttt |
33871910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 47716540 - 47716592
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||| ||||| ||||||||| |
|
|
| T |
47716540 |
gggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgcc |
47716592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 13792206 - 13792164
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
13792206 |
gggaccccttctcgaaccctgcgtatgctggagcttttgtgca |
13792164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 21139804 - 21139762
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||||||||| ||| |||||||| |||||||||||| |
|
|
| T |
21139804 |
gggaccccttcccgaactctgtgtatgcggaagctttagtgca |
21139762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 61
Target Start/End: Complemental strand, 36267865 - 36267831
Alignment:
| Q |
27 |
ttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36267865 |
ttcccgaaccctgtgtatgcgggagctttagtgca |
36267831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 39123974 - 39124016
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| ||||| |
|
|
| T |
39123974 |
gggaccccttcccggaccctgcgtatgagggagctttggtgca |
39124016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 43557553 - 43557611
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagc-tttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||| ||||| || |||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
43557553 |
gggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgccctttt |
43557611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 1408536 - 1408593
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||||||||| | | ||||||| || ||| |||||||||| |
|
|
| T |
1408536 |
gggaccccttcccggaccctgcgtatgcagaatctttagttcaccggattgccttttt |
1408593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 27629713 - 27629770
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| |||||| ||||||| ||||| |||||| ||||||||| |||| |
|
|
| T |
27629713 |
gggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttgccctttt |
27629770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 29907499 - 29907549
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29907499 |
gggaccccatcccggaccctg--tatgcgggagctttagtgcaccgggttgcc |
29907549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 33500594 - 33500635
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgc |
60 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||| ||||| |
|
|
| T |
33500594 |
gggaccccttcccggaccctgcgtatgcgggatcttcagtgc |
33500635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 61
Target Start/End: Complemental strand, 14732871 - 14732835
Alignment:
| Q |
25 |
ccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14732871 |
ccttcccgaaccctgtttatgcgggagctttagtgca |
14732835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 75
Target Start/End: Original strand, 24634233 - 24634285
Alignment:
| Q |
23 |
ccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttt |
75 |
Q |
| |
|
||||||||||||||||| ||||| || |||||||||||| |||| || ||||| |
|
|
| T |
24634233 |
ccccttcccgaaccctgtgtatgtggaagctttagtgcaccgggctgtctttt |
24634285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 75
Target Start/End: Complemental strand, 1643 - 1587
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcctttt |
75 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
1643 |
gggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttgcctttt |
1587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 59058 - 59110
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
59058 |
gggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgcc |
59110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 10889 - 10940
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgc |
70 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10889 |
gggaccccttcccggaccctgcgtatgcgggagctttagtgcactgggttgc |
10940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0954 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0954
Description:
Target: scaffold0954; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 3623 - 3665
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3623 |
gggaccccttcccgaaccctgcgtatgcggcagctttagtgca |
3665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 48690 - 48632
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttta |
77 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
48690 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
48632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 13080 - 13023
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||| ||||||||| |||| |
|
|
| T |
13080 |
gggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgccctttt |
13023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 30656 - 30713
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
30656 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
30713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 24189 - 24132
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgccttttt |
76 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||| ||| ||||| |||| |
|
|
| T |
24189 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctttt |
24132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 71
Target Start/End: Complemental strand, 72920 - 72871
Alignment:
| Q |
22 |
accccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||| | ||||||| |
|
|
| T |
72920 |
accccttcccggaacctgcgtatgcgggagctttagtgcaccaggttgcc |
72871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 11208 - 11260
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
||||| |||||||| ||||||| |||||||||||| ||||||| | ||||||| |
|
|
| T |
11208 |
gggacaccttcccggaccctgcatatgcgggagctctagtgcaccaggttgcc |
11260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 10106 - 10054
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||| ||||| |||||| |||||| ||||||||| |
|
|
| T |
10106 |
gggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgcc |
10054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 20434 - 20382
Alignment:
| Q |
19 |
gggaccccttcccgaaccctgcgtatgcgggagctttagtgcatcgggttgcc |
71 |
Q |
| |
|
|||||||||||||| ||||||| ||||| |||||| |||||| ||||||||| |
|
|
| T |
20434 |
gggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgcc |
20382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University