View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20278_low_19 (Length: 255)
Name: NF20278_low_19
Description: NF20278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20278_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 20 - 245
Target Start/End: Complemental strand, 43740921 - 43740694
Alignment:
| Q |
20 |
gaactactgatattaaggttctaaactctattgtgttgttatgcctgttggtgtatatatacgcacacgtttcatatatagtgcatatgctttgattctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43740921 |
gaactactgatattaaggttctaaactctattgtgttgttatgcctgttggtgtatatatacgcacacgtttcatatatagtgcatatgctttgattctt |
43740822 |
T |
 |
| Q |
120 |
taacaatactaataattaaaacttcggaacgg--nnnnnnnnnnntctttgtttgtttaaagtaaaataataaagcttgctgctcaatatatagatagtt |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43740821 |
taacaatactaataattaaaactttggaacggaaaaaaaaaataatctttgtttgtttaaagtaaaataataaagcttgctgctcaatatatagatagtt |
43740722 |
T |
 |
| Q |
218 |
aagtcaacaaattttgaatttagtataa |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43740721 |
aagtcaacaaattttgaatttagtataa |
43740694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University