View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2027_high_9 (Length: 236)

Name: NF2027_high_9
Description: NF2027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2027_high_9
NF2027_high_9
[»] chr4 (2 HSPs)
chr4 (1-87)||(39748730-39748816)
chr4 (146-220)||(39748869-39748943)


Alignment Details
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 39748730 - 39748816
Alignment:
1 tcaaaatatagaagttaacttgtatcacggacatgacctaatacatgtcacatgtctgcacacatgtgattggattcaactagatca 87  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||    
39748730 tcaaaatatagaagttaacttgtatcacggacatgatctaatacatgtcacatgtatgcacacatgtgattggattcaactagatca 39748816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 146 - 220
Target Start/End: Original strand, 39748869 - 39748943
Alignment:
146 ataggaagtaactcatgggtgattgttatgttgtttcaggatggatatggatatggattgagaccgagactgagg 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||    
39748869 ataggaagtaactcatgggtgattgttatgttgtttcaggatggagatggatatggattgagaccgagaccgagg 39748943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University