View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2027_high_9 (Length: 236)
Name: NF2027_high_9
Description: NF2027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2027_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 39748730 - 39748816
Alignment:
| Q |
1 |
tcaaaatatagaagttaacttgtatcacggacatgacctaatacatgtcacatgtctgcacacatgtgattggattcaactagatca |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39748730 |
tcaaaatatagaagttaacttgtatcacggacatgatctaatacatgtcacatgtatgcacacatgtgattggattcaactagatca |
39748816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 146 - 220
Target Start/End: Original strand, 39748869 - 39748943
Alignment:
| Q |
146 |
ataggaagtaactcatgggtgattgttatgttgtttcaggatggatatggatatggattgagaccgagactgagg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
39748869 |
ataggaagtaactcatgggtgattgttatgttgtttcaggatggagatggatatggattgagaccgagaccgagg |
39748943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University