View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2027_low_14 (Length: 209)
Name: NF2027_low_14
Description: NF2027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2027_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 52 - 199
Target Start/End: Original strand, 28478884 - 28479031
Alignment:
| Q |
52 |
aaatgaataatgaaatgatgtggcaaaagatgtggcgtatggaaagtatttggaattatttgataatgtgtgatttctttgtgttctgattggttggtga |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28478884 |
aaatgaataatgaaatgatgtggcaaaagatgtggcgtatggaaagtttttggaattatttgagaatgtgtgatttctttgtgttctgattggttggtga |
28478983 |
T |
 |
| Q |
152 |
gtacacgttttatccacactccttcaattctatcatcatccctctctg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28478984 |
gtacacgttttatccacactccttcaattctatcatcatccctctctg |
28479031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University