View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2027_low_7 (Length: 288)
Name: NF2027_low_7
Description: NF2027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2027_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 278
Target Start/End: Original strand, 49412576 - 49412836
Alignment:
| Q |
18 |
gctggaggtgaagttatggaggattatgacgatgttgaagacaagtttcagcctcagaaagggaatgtcgtgtttgcttgtgctttggatggtcggggtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49412576 |
gctggaggtgaagttatggaggattatgacgatgttgaagacaagtttcagcctcagaaagggaatgtcgtgtttgcttgtgctttggatggttggggtt |
49412675 |
T |
 |
| Q |
118 |
ttgggattcatgaatttgctgagatttatgcttcaaagcttggtggtagtgctagtgtgggtgcattgctgagggctttgtggggtccatggtattataa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49412676 |
ttgggattcatgaatttgctgagatttatgcttcaaagcttggtggtagtgctagtgtgggtgcattgctgagggctttgtggggtccatggtattataa |
49412775 |
T |
 |
| Q |
218 |
tccgaagacgaagatgattgttggaaagaaagggattagtggtagtaaggctaggcctatg |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49412776 |
tccgaagacgaagatgattgttggaaagaaagggattagtggtagtaaggctaggcctatg |
49412836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 270
Target Start/End: Original strand, 23737946 - 23738014
Alignment:
| Q |
202 |
gtccatggtattataatccgaagacgaagatgattgttggaaagaaagggattagtggtagtaaggcta |
270 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||||| ||| || ||||||||||||||||||||||||| |
|
|
| T |
23737946 |
gtccacggtattttaatacgaagacgaagatgatttgtgggaacaaagggattagtggtagtaaggcta |
23738014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University