View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20281_high_6 (Length: 333)
Name: NF20281_high_6
Description: NF20281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20281_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 145 - 316
Target Start/End: Complemental strand, 43977003 - 43976831
Alignment:
| Q |
145 |
tcgatgttcaagacgaa-acataatcaagagtgtcgtatataaatggaatatccccttcgagtcgctttcccgcgcctttattctttgtcaattcaaaag |
243 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43977003 |
tcgatgttcaagacaaacacataatcaagagtgccgtatataaatggaagatccccttcgagtcgctttcccgcgcctttattctttgtcaattcaaaag |
43976904 |
T |
|
| Q |
244 |
gaggcgcttgtcggtgagatgtgggcggcgagggatggtgttggagagtggagtttgttgtggaggcgtaact |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43976903 |
gaggcgcttgtcggtgagatgtgggcggcgagggatggtgttggagagtggagtttgttgtggaggcgtaact |
43976831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 9 - 71
Target Start/End: Complemental strand, 43977139 - 43977077
Alignment:
| Q |
9 |
cgagagtgaggaggaattttaaaactaaaacattctcatgattttaaaactattttattaaac |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43977139 |
cgagagtgaggaggaattttaaaactaaaacattctcctgattttaaaactattttattaaac |
43977077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University