View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20281_low_1 (Length: 532)
Name: NF20281_low_1
Description: NF20281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20281_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 9e-59; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 9e-59
Query Start/End: Original strand, 17 - 136
Target Start/End: Original strand, 51708573 - 51708692
Alignment:
| Q |
17 |
catcttgattaagcaaattatatggaaaaaagagttcaactctgtatcttgacaaatcaatcttatttaggtgcacattcactcttaatcaagagaggga |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51708573 |
catcttgattaaacaaattatatggaaaaaagagttcaactctgtatcttgacaaatcaatcttatttaggtgcacattcactcttaatcaagagaggga |
51708672 |
T |
 |
| Q |
117 |
gaaattgatatttgaaatta |
136 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
51708673 |
gaaattgatatttgaaatta |
51708692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 179 - 297
Target Start/End: Original strand, 51709075 - 51709196
Alignment:
| Q |
179 |
tggcagccttgatttccacaaaaatgggtgtgtttgggaaggtgtggaaggaaaagatgaaagctaaggttgaaatgaggaaaaaaggaaagattc---c |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
51709075 |
tggcagccttgatttccacaaaaatgggtgtgtttgggaaggtgtggaaggaaaagatgaaagctaaggttgaaatgaggaaaaaaggaaagattccttc |
51709174 |
T |
 |
| Q |
276 |
ttctctttagcttttgtcttgt |
297 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
51709175 |
ttctctttagcttttgtcttgt |
51709196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 333 - 407
Target Start/End: Original strand, 51709194 - 51709268
Alignment:
| Q |
333 |
tgtggagaaagattcctgaaaaagtagcacaaatatgggatgtatgaagaagatgatttctgattaagtcaactt |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51709194 |
tgtggagaaagattcctgaaaaagtagcacaaatatgggatgtatgaagaagatgatttatgattaagtcaactt |
51709268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 131 - 162
Target Start/End: Original strand, 51709031 - 51709062
Alignment:
| Q |
131 |
aaattaattccaatttcaaattcatgctgcag |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51709031 |
aaattaattccaatttcaaattcatgctgcag |
51709062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University