View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20281_low_3 (Length: 471)

Name: NF20281_low_3
Description: NF20281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20281_low_3
NF20281_low_3
[»] chr2 (1 HSPs)
chr2 (1-122)||(12830410-12830531)


Alignment Details
Target: chr2 (Bit Score: 118; Significance: 5e-60; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 12830531 - 12830410
Alignment:
1 ttttattcattaatatttgtaagaattttgtccttttattctattaacttgcaacataatcattttcggttttagtgatattaaatttgtagtgttcata 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
12830531 ttttattcattaatatttgtaagaattttgtccttttattctattaacttgcaaaataatcattttcggttttagtgatattaaatttgtagtgttcata 12830432  T
101 ttagtgatacttgcctcaaggt 122  Q
    ||||||||||||||||||||||    
12830431 ttagtgatacttgcctcaaggt 12830410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University