View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20281_low_4 (Length: 448)
Name: NF20281_low_4
Description: NF20281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20281_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 337; Significance: 0; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 17 - 385
Target Start/End: Complemental strand, 7502428 - 7502060
Alignment:
| Q |
17 |
aatgctgtaccaattatctcaagggctcttgttaaactttctatgaaaaaccacaacattctccttgctataccatcacaagttgatgcatccctcactg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7502428 |
aatgctgtaccaattatctcaagggctcttgttaaactttctatgaaaaaccacaacattctccttgctataccatcacaagttgatgcatccctcactg |
7502329 |
T |
|
| Q |
117 |
acacagccaatatcgtttggctctggcccgcactcttttctggtgagggccctatgtgcattgaagcggtaaacttcaaaatcagaactttattgaattc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7502328 |
acacagccaatatcgtttggctctggcccgcactcttttctggtgagggccctatgtgcattgaagaggtaaacttcaaaatcagaactttattgaattc |
7502229 |
T |
|
| Q |
217 |
acatatcacaaccatcaacttgttctaattctgcttgttatagcagtggtcgtcggaagaacaagtgcagaagcaagcaccgggcggggaaagtgacgtc |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7502228 |
acatatcacaaccatcaacttgttctaattctgcttgttatagcagtggtcgtcggaagaacaagtgcagaagcaagcaccaggcggggaaagtgacgtc |
7502129 |
T |
|
| Q |
317 |
tagtgtcatggnnnnnnnnttggtaaactaaagagttccctttttcttggtttcttcatgcagttctga |
385 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7502128 |
tagtgtcatggaaaaaaaattggtaaactaaagagttccctttttcttggtttcttcatgcagttctga |
7502060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 148 - 222
Target Start/End: Original strand, 8139450 - 8139524
Alignment:
| Q |
148 |
actcttttctggtgagggccctatgtgcattgaagcggtaaacttcaaaatcagaactttattgaattcacatat |
222 |
Q |
| |
|
|||||||||||||| | |||||||| ||||||| ||||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
8139450 |
actcttttctggtgggagccctatgctcattgaacaggtaaccttcaaaatcaaaactttatggaattcacatat |
8139524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 184 - 271
Target Start/End: Complemental strand, 7499215 - 7499127
Alignment:
| Q |
184 |
ggtaaacttcaaaatcagaactttattgaattcacata-tcacaaccatcaacttgttctaattctgcttgttatagcagtggtcgtcg |
271 |
Q |
| |
|
||||| ||||||||||| |||||||| ||||||||||| |||||||||| ||| ||| | |||||| ||||| || |||||||||||| |
|
|
| T |
7499215 |
ggtaaccttcaaaatcaaaactttatggaattcacatattcacaaccataaacgagtttttattctgattgttctaacagtggtcgtcg |
7499127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 273 - 327
Target Start/End: Original strand, 8139599 - 8139653
Alignment:
| Q |
273 |
aagaacaagtgcagaagcaagcaccgggcggggaaagtgacgtctagtgtcatgg |
327 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| || ||||||||||||| |
|
|
| T |
8139599 |
aagaacaagtgcagaagcaagtgccgggcagggaaagtcacatctagtgtcatgg |
8139653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University