View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20282_low_12 (Length: 231)
Name: NF20282_low_12
Description: NF20282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20282_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 1247676 - 1247459
Alignment:
| Q |
1 |
cagtaccaacaagagaactttgtcgaaaatcaggtcttgagaatccaaactcaacatcagtaacatcaccagatgaaagaacaccatcgttctggaaact |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1247676 |
cagtaccaacaagagaactttgccgaaaatcaggtcttgagaatccaaactcaacatcagcaacatcaccagatgaaagaacaccatcgttctggaaact |
1247577 |
T |
|
| Q |
101 |
tccagaagcgcttcttggatcggtgaggtaactatcgagtgtgtcagagacggtgattggtgaggaatgagaggaagatgatggcattgtgaatgttaag |
200 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1247576 |
tccagaagcgcttcttgggtcagtgaggtaactatcgagtgtgtcagagacggtgattggtgaggaatgagaggaagatgatgggattgtgaatgttaag |
1247477 |
T |
|
| Q |
201 |
ggttcttctctgtctctg |
218 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
1247476 |
ggttcttctctttctctg |
1247459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 42014448 - 42014231
Alignment:
| Q |
1 |
cagtaccaacaagagaactttgtcgaaaatcaggtcttgagaatccaaactcaacatcagtaacatcaccagatgaaagaacaccatcgttctggaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42014448 |
cagtaccaacaagagaactttgtcgaaaatcaggtcttgagaatccaaactcaacatcggcaacatcaccagatgaaagaacaccatcgttctggaaact |
42014349 |
T |
|
| Q |
101 |
tccagaagcgcttcttggatcggtgaggtaactatcgagtgtgtcagagacggtgattggtgaggaatgagaggaagatgatggcattgtgaatgttaag |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42014348 |
tccagaagcgcttcttgggtcggtgaggtaactatcgagtgtgtcagagacggtgatcggtgaggaatgagaggaagatgatgggattgtgaatgttaaa |
42014249 |
T |
|
| Q |
201 |
ggttcttctctgtctctg |
218 |
Q |
| |
|
| ||||||||| |||||| |
|
|
| T |
42014248 |
gattcttctctttctctg |
42014231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University