View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20282_low_9 (Length: 280)
Name: NF20282_low_9
Description: NF20282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20282_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 261
Target Start/End: Complemental strand, 48399551 - 48399307
Alignment:
| Q |
17 |
aaaacttgaggttacaagtcgattccatctaggcaaaataagttgaggtaaaaactcaaatttgattgtttggaggtagtctccaagtgtagcttgtgtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48399551 |
aaaacttgaggttacaagtcgattccatctaggcaaaataagttgaggtaaaaactcaaatttgattgcttggaggtagtctccaagtgtagcttgtgtt |
48399452 |
T |
|
| Q |
117 |
aggcaacttcacaataaaaatcaacacatattttgcgatttttcttttgctcaattgtagtagtcttgattaacttcaagtccaagtattcatcctcgtt |
216 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48399451 |
aggcaacttcacaataaaagtcaacacatattttgcgattgttcttttgctcaattgtagtagtcttgattaacttcaagtccaagtattcatcctcgtt |
48399352 |
T |
|
| Q |
217 |
tagcccaattttgctatttgtgacatgaaatggtcctctccggtt |
261 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48399351 |
tagcccaattttgccatttgtgacatgaaatggtcctctccggtt |
48399307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University