View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20283_low_7 (Length: 210)
Name: NF20283_low_7
Description: NF20283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20283_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 7e-48; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 95 - 195
Target Start/End: Original strand, 47726730 - 47726830
Alignment:
| Q |
95 |
gcaagttttctatgactgattattattgcaagtgttcgccaacaaaaccacttcaaacgaataattgagttattttatttttgatattctttggtggatg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47726730 |
gcaagttttctatgactgattattattgtaagtgttcgccaacaaaaccacttcaaacgaataattgagttattttatttttgatattctttggtggatg |
47726829 |
T |
 |
| Q |
195 |
a |
195 |
Q |
| |
|
| |
|
|
| T |
47726830 |
a |
47726830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 95 - 195
Target Start/End: Original strand, 47748036 - 47748136
Alignment:
| Q |
95 |
gcaagttttctatgactgattattattgcaagtgttcgccaacaaaaccacttcaaacgaataattgagttattttatttttgatattctttggtggatg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47748036 |
gcaagttttctatgactgattattattgtaagtgttcgccaacaaaaccacttcaaacgaataattgagttattttatttttgatattctttggtggatg |
47748135 |
T |
 |
| Q |
195 |
a |
195 |
Q |
| |
|
| |
|
|
| T |
47748136 |
a |
47748136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 151 - 195
Target Start/End: Original strand, 47719794 - 47719838
Alignment:
| Q |
151 |
acgaataattgagttattttatttttgatattctttggtggatga |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47719794 |
acgaataattgagttattttatttttgatattctttggtggatga |
47719838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University