View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20285_high_2 (Length: 399)
Name: NF20285_high_2
Description: NF20285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20285_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 35 - 316
Target Start/End: Complemental strand, 48286532 - 48286251
Alignment:
| Q |
35 |
gaaccgaggtggaattctggtatggaaggttgatagagaatgtagataactgcggcggcgaggatgaaaaggaagaagagaatgaggaagatgatgcaaa |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286532 |
gaaccgaggtggaattctggtatggaaggttggtagagaatgtagataactgcggcggcgaggatgaaaaggaagaagagaatgaggaagatgatgcaaa |
48286433 |
T |
 |
| Q |
135 |
atgtgcaacaacataggcgacaataattacgtttcttgggttttggtcggaaagaaggtgggagagaagggttccgtgttggaagcggtttttgttggat |
234 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48286432 |
atgtgcaacaaaataggcgacaataattacgtttcttgggttttggtcggaaagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggat |
48286333 |
T |
 |
| Q |
235 |
gtttgggtctctataacaaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcattgtgattttgtgt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286332 |
gtttgggtctctataacaaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcattgtgattttgtgt |
48286251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University