View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20286_high_5 (Length: 329)
Name: NF20286_high_5
Description: NF20286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20286_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 20 - 286
Target Start/End: Original strand, 32582481 - 32582747
Alignment:
| Q |
20 |
actcgacgctgcatcttcatcgttacggtgattctcaacatgcgccagaacttgttctaattcgttacgtaacgtgtttacagcagattcgttagtcaaa |
119 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32582481 |
actcgacgctgcatcgtcatcgttacggtgattctcaacatgcgccagaacttgttctaattcgttacgtaacgtgtttacagcagattcgtttgtcaaa |
32582580 |
T |
|
| Q |
120 |
gccatttctctccaaatctgattctccataatcagtgttttcgctttttcttgaagcattagattttgtttctccattctctgaatctcttcttcttttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32582581 |
gccatttctctccaaatctgattctccataatcagtgttttcgctttttcttgaagcattagattttgtttctccattctctgaatctcttcttcttttt |
32582680 |
T |
|
| Q |
220 |
gcttcagtttctttgttactgcttcttggattgccgcttgtagcattcttgattgcttcaatctttg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32582681 |
gcttcagtttctttgttactgcttcttggattgccgcttgtagcattcttgattgcttcaatctttg |
32582747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University