View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20287_high_23 (Length: 214)
Name: NF20287_high_23
Description: NF20287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20287_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 40961730 - 40961770
Alignment:
| Q |
1 |
gatttgaatttgatgtaggcgttataaaaagttaacaaata |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40961730 |
gatttgaatttgatgtaggcgttataaaaaattaacaaata |
40961770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University