View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20288_high_12 (Length: 305)
Name: NF20288_high_12
Description: NF20288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20288_high_12 |
 | |
|
| [»] scaffold0027 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 247; Significance: 1e-137; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 18 - 296
Target Start/End: Complemental strand, 32925629 - 32925351
Alignment:
| Q |
18 |
gtatataaacccctttcattgctaatgagaataacaagtttgcaatcaatgtaacattctctttttctctctcaattctcttaggaaaactgattacttg |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32925629 |
gtatataaacccctttcattgctgatgagaataacaagtttgcaatcaatggaacattctgtttttctctctcaattctcttaggaaaactgattacttg |
32925530 |
T |
|
| Q |
118 |
cactgcaagtaattactgctgcgctatcaagcacttcccgggctgaagcgaattgccagaagaggtagcattttcaacttcatgctttgatgtgaggtca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32925529 |
cactgcaagtaattactgctgcgctatcaagcactgccccggctgaagcgaattgccagaagaggtagcattttcaacttcatgctttgatgtgaggtca |
32925430 |
T |
|
| Q |
218 |
gaaatggatccaacttctgcagtacaagaatactattgtaggttgattcgctgattatgtttagtcttctagcttcatc |
296 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32925429 |
gaaatggatccaacttcttcagtacaagaatgctattgtaggttgattcactgattatgtttagtcttctagcttcatc |
32925351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 147 - 233
Target Start/End: Complemental strand, 32920446 - 32920360
Alignment:
| Q |
147 |
agcacttcccgggctgaagcgaattgccagaagaggtagcattttcaacttcatgctttgatgtgaggtcagaaatggatccaactt |
233 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
32920446 |
agcactgccctggctgaagcgaattgccagaagaggtagcattttcaacttcatgctttgatgcgaggtcagaaatggctccaactt |
32920360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 231 - 296
Target Start/End: Complemental strand, 32920334 - 32920269
Alignment:
| Q |
231 |
cttctgcagtacaagaatactattgtaggttgattcgctgattatgtttagtcttctagcttcatc |
296 |
Q |
| |
|
|||||||||||| ||||| |||||| |||||| ||| |||||||||||||||||| |||||||||| |
|
|
| T |
32920334 |
cttctgcagtacgagaatgctattgaaggttggttcactgattatgtttagtcttttagcttcatc |
32920269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 94
Target Start/End: Complemental strand, 54844 - 54780
Alignment:
| Q |
30 |
ctttcattgctaatgagaataacaagtttgcaatcaatgtaacattctctttttctctctcaatt |
94 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
54844 |
ctttcattcctaatgagaataacaagtttacaatcaatagttcattctcttcttctctctcaatt |
54780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 67
Target Start/End: Original strand, 25334611 - 25334647
Alignment:
| Q |
31 |
tttcattgctaatgagaataacaagtttgcaatcaat |
67 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
25334611 |
tttcattgctaatgtgaataacaagttttcaatcaat |
25334647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University