View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20288_low_13 (Length: 328)
Name: NF20288_low_13
Description: NF20288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20288_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 57 - 155
Target Start/End: Complemental strand, 31008734 - 31008636
Alignment:
| Q |
57 |
aaacttttgaagccaacaacatgcatttaacttccatgaaattaaaaacacataaaatatgaactaacaaaatattgacaaacataaagatacaaccat |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31008734 |
aaacttttgaagccaacaacatgcatttaacttccatgaaattaaaaatacataaaatatgaactaataaaatattgacaaacataaagatacaaccat |
31008636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University