View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20288_low_15 (Length: 300)
Name: NF20288_low_15
Description: NF20288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20288_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 284
Target Start/End: Complemental strand, 34667798 - 34667522
Alignment:
| Q |
11 |
atgaaagtaaacaataaattagtgaacaatggtcagagtggaaatagacttggatctcttaagcaaggtctcagatacaagtcttgtagacgggaaaaaa |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34667798 |
atgaaactaaacaataaattagtgaacaatggtcagagtggaaatagacttggatctcttaagcaaggtctcagatacgagtcttgtagacgggaaaaaa |
34667699 |
T |
|
| Q |
111 |
tgtggttggtagaagagactctgctaatggttaccggtgagattttcggacggaaattagtacaaagctacttcacaccaattatatagttac---nnnn |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34667698 |
tgtggttggtagaagagactctgctaatggttaccggtgagattttcggacggaaattagtacaaagctacttcacaccaattatatagttacaaaaatt |
34667599 |
T |
|
| Q |
208 |
nnnnnnnnnncaacatattacccttcacccaacaaatgcacttgtggaactagttttgtaatctcttctcccaattg |
284 |
Q |
| |
|
|| |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34667598 |
aaaaaaaattaaaattattacccttcacccagcaaatgcacttgtggaactatttttgtaatctcttctcccaattg |
34667522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University