View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20289_low_10 (Length: 209)

Name: NF20289_low_10
Description: NF20289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20289_low_10
NF20289_low_10
[»] chr2 (1 HSPs)
chr2 (1-45)||(41759251-41759295)


Alignment Details
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 41759251 - 41759295
Alignment:
1 caacgtattttacatgtaaaaatgaattagtgatgaaatatttgt 45  Q
    ||||||||||||||||||||||||||||| |||||||||||||||    
41759251 caacgtattttacatgtaaaaatgaattactgatgaaatatttgt 41759295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University