View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20289_low_6 (Length: 302)
Name: NF20289_low_6
Description: NF20289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20289_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 4 - 289
Target Start/End: Complemental strand, 5015685 - 5015399
Alignment:
| Q |
4 |
gtatggcgagcaacaccgtgtgaaaggctttgatatttctaaacctcattcctcatatactttaaggtttacaacatttgtttcagttgagctagcgta- |
102 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5015685 |
gtatggcgagcaacaccgtgtgaaagactttgatatttctaaacctcattcctcatatacgttaaggtttacaacatttgtttcagttgagctagcgtaa |
5015586 |
T |
 |
| Q |
103 |
ttttattgtaactataaccacatcaaaattgctttatcattgctacaatatcatcaaataatcatatctggataagaggaaacgatccatgatatgtgtt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5015585 |
ttttattgtaactataaccacatcaaaattgctttatcattgcttcaatatcatcaaataatcatatctggataagaggaaacgatccatgatatgtgtt |
5015486 |
T |
 |
| Q |
203 |
tgtaagaatggactacgcaagagatttaatgagcacctcgcgacctgctgaagatataagaatttatcctgccaacctttcttcttc |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5015485 |
tgtaagaatggactacgcaagagatttaatgagcacctcgcgacctgctgaagatataagaatttatcctgccaacctttcttcttc |
5015399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University