View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2028_high_12 (Length: 294)
Name: NF2028_high_12
Description: NF2028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2028_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 5 - 287
Target Start/End: Complemental strand, 33948218 - 33947936
Alignment:
| Q |
5 |
tggaggagtaggtggtgaaactggtagaacaacctccatgcttgtttgtggaaccaaattccaaaccaaacagttgctatggtggaaatggaaaatgggt |
104 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33948218 |
tggaggagtaggtggtgcaactggtagaacaacctccatgtttgtttgtggaaccaaattccaaaccaaacagttgctatggtggaaatggaaaatgggt |
33948119 |
T |
 |
| Q |
105 |
gtcggttggaatgtgaaggggtgattatatagagaagggaagtggggaaggatagaggaaagaggggggtatgagtgggaaagattgacttttgagtgaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33948118 |
gtcggttggaatgtgaaggggtgattatatagagaagggaagtggggaaggatagaggaaagaggggggtatgagtgggaaagattgacttttgagtgaa |
33948019 |
T |
 |
| Q |
205 |
ggactagactggtttttagaaggagcagcctttactagactaccaattgttttccttgctatcattaattatagtatattctt |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33948018 |
ggactagactggtttttagaaggagcagcctttactagactaccaattgttttccttgctatcattaattatagtattttctt |
33947936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University