View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2028_low_13 (Length: 360)

Name: NF2028_low_13
Description: NF2028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2028_low_13
NF2028_low_13
[»] chr4 (1 HSPs)
chr4 (19-96)||(3003752-3003825)
[»] chr5 (1 HSPs)
chr5 (198-255)||(15202442-15202499)


Alignment Details
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 96
Target Start/End: Original strand, 3003752 - 3003825
Alignment:
19 atgaacatggtataatcgtcagcaattaataaccagtgaggttgatggatatgaaataaccaagaaacaaacataaat 96  Q
    |||||||||||||||| ||||||   |||||||||||||||||| | |||||||||||||||||||||||||||||||    
3003752 atgaacatggtataattgtcagc---taataaccagtgaggttg-tagatatgaaataaccaagaaacaaacataaat 3003825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 198 - 255
Target Start/End: Original strand, 15202442 - 15202499
Alignment:
198 tactaatctcaatatgccttcttaattcaaactttcaaaagtcaccactcctagttcc 255  Q
    ||||||||| || ||||||||||||| |||| |||||||||  || ||||||||||||    
15202442 tactaatcttaacatgccttcttaatgcaaattttcaaaagctacaactcctagttcc 15202499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University