View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2028_low_18 (Length: 273)
Name: NF2028_low_18
Description: NF2028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2028_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 35 - 261
Target Start/End: Complemental strand, 394490 - 394269
Alignment:
| Q |
35 |
taaatagattttgttacattgagagttgggtgaattttgtatatttagttaattaggtaaggaaatggaaagaacgaaagcataaatacataagaaaagt |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
394490 |
taaatagattttgttacattgagagttgggtgaattttgtatatttagtta----ggtaagaaaatggaaagaacgaaagcataaatacataagaaaagt |
394395 |
T |
 |
| Q |
135 |
tgagttaatatgtgtgtgtacttggaaatgggagggttctccctgtctaactaaacatatgaaagatatgaggtacacaaaattgttgataattaattct |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
394394 |
tgagttaatatgtgtgtgtacttggaaatgggagggttctccctgtctaactaaacatatgaaagatctgaggtacacaaaattgttgat-attaattct |
394296 |
T |
 |
| Q |
235 |
tggtatggtgtggtgcatttcatctca |
261 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
394295 |
tggtatggtgtggtgcatttcatctca |
394269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University