View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2028_low_19 (Length: 269)
Name: NF2028_low_19
Description: NF2028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2028_low_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 33948611 - 33948343
Alignment:
| Q |
1 |
ttcttcaattgcagcttcaaatggcttagaatctctctcagtattatcatgaacagcttttttctttcgggttctcggagaatttggtggcaagggtttc |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33948611 |
ttcttcaattgcagcttcaaatggattagaatctctctcagtattatcatgaaccgcttttttctttcgggttctcggagaatttggtggcaacggtttc |
33948512 |
T |
 |
| Q |
101 |
atgggacggatctttccaccgtcaaagagttcatcggcggcggaaagagactctttttggaggttgccactgaaatcaaactcaaaatcgtcatcgttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33948511 |
atgggacggatctttccaccgtcaaagagttcatcggcggcggaaagagactctttttggaggttgccactgaaatcaaactcaaaatcgtcatcgttgc |
33948412 |
T |
 |
| Q |
201 |
caaaactgcagttgttatggtggttgttgagtttggtttcttgatgaaaaggaagagaggattcagaga |
269 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33948411 |
caaaactgtagttgttatggtggttgttgggtttggtttcttgatgaaaaggaagagaggattcagaga |
33948343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University