View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2028_low_21 (Length: 253)
Name: NF2028_low_21
Description: NF2028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2028_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 36315947 - 36316186
Alignment:
| Q |
19 |
atgacgttggttatagggaaatgctaagcagtggccctgagacaccagttaaggaagctaaaaagtctaaaaaatatcattttcaatttaaaacttcctt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36315947 |
atgacgttggttatagggaaatgctaagcggtggccctgagacaccggttaaggaagctaaaaagtctaaaaaatatcattttcaatttaaaacttcctt |
36316046 |
T |
 |
| Q |
119 |
aaccagttctccgagtgcattgggttagcatcacccttgatgatacatactagttcattatatacatcactgtgtataa---------------attttc |
203 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36316047 |
aaccagttctccgagtgcattgg-ttagcatcacccttgatgatacatactagttcattatatacatcactgtgtataaattttctactcataaattttc |
36316145 |
T |
 |
| Q |
204 |
tataattttcattttgaagtatcactgtgtgtcagtataat |
244 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36316146 |
tataattttcattttgaagtatcattgtgtgtcagtataat |
36316186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University