View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2028_low_25 (Length: 240)
Name: NF2028_low_25
Description: NF2028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2028_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 44737573 - 44737780
Alignment:
| Q |
16 |
atgaaagcgtgcatatgaagaggggagtaatcgaggtgaatgtggggtatctagcagacaaaaacgtgtgttggagctgagcttctttctcttcaaccgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44737573 |
atgaaagcgtgcatatgaagaggggagtaatcgaggtgaatgtggggtatctagcagacaaaaacgtgtgttggagctgagcttctttctcttcaaccgt |
44737672 |
T |
|
| Q |
116 |
cccttattcgcatggcgtgcgcctcacctttacaactacaacatgtcatggtgcgctgctgtgcggccttcagccctcattcccatacgacaactgcctg |
215 |
Q |
| |
|
| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44737673 |
ctcttattcgcatggcgtgcgtctcacctttacaactacaacatgtcatggtgcgctgctgtgcggccttcagccctcattcccacacgacaactgcctg |
44737772 |
T |
|
| Q |
216 |
tacccggt |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
44737773 |
tacccggt |
44737780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University