View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20290_low_11 (Length: 239)
Name: NF20290_low_11
Description: NF20290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20290_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 130 - 193
Target Start/End: Original strand, 36290812 - 36290875
Alignment:
| Q |
130 |
cttctcaaaacacagtgtaagcatatgctccaacattccaatacatatgtccgtcccttccgtc |
193 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36290812 |
cttctcaaaagacagtgtaagcatatgctccaacattccaatacatatgtccgtcccttccgtc |
36290875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University