View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20290_low_11 (Length: 239)

Name: NF20290_low_11
Description: NF20290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20290_low_11
NF20290_low_11
[»] chr1 (1 HSPs)
chr1 (130-193)||(36290812-36290875)


Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 130 - 193
Target Start/End: Original strand, 36290812 - 36290875
Alignment:
130 cttctcaaaacacagtgtaagcatatgctccaacattccaatacatatgtccgtcccttccgtc 193  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
36290812 cttctcaaaagacagtgtaagcatatgctccaacattccaatacatatgtccgtcccttccgtc 36290875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University