View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20290_low_6 (Length: 339)
Name: NF20290_low_6
Description: NF20290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20290_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 26 - 324
Target Start/End: Original strand, 7165621 - 7165916
Alignment:
| Q |
26 |
ttcttgaagtattaaccaccaatcaaccatttgttttacttctcaaccaccattatcaccaaaattttaattcacttttatccttttcgtcgtgtcacaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7165621 |
ttcttgaagtattaaccaccaatcaaccatttgttttacttctcaaccaccattatcaccaaaattttaattcacttttatcattttcgtcgtgtcacaa |
7165720 |
T |
 |
| Q |
126 |
tcgttaatactatataaagcttttgtcaaaaaactataactaaaaattatttatggtcaaatgtgatcaataccatctcaatctcatttacgtagatatt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7165721 |
tcgttaatactatataaagcttttgtcaaaaaactataactgaaaa----ttatggtcagatgtgatcaataccatctcaatctcatttacgtagatatt |
7165816 |
T |
 |
| Q |
226 |
taaaacttagatatctttagcttgtcattaacccttt-nnnnnnntagttgtgacatccatgtcatcaccatctttaccacctaggtacctattccctgt |
324 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
7165817 |
taaaacttagatatctatagcttgtcattaaccctttaaaaaaaatagttgtgacatccatgtcatcaccatctttgccacctaggtacctattcactgt |
7165916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University