View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20290_low_9 (Length: 277)

Name: NF20290_low_9
Description: NF20290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20290_low_9
NF20290_low_9
[»] chr3 (1 HSPs)
chr3 (86-259)||(30810246-30810419)


Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 86 - 259
Target Start/End: Original strand, 30810246 - 30810419
Alignment:
86 tcatcaccctttacatctttgattctgcttctctcttaatggtaccactctccatttttcagaaattcgatagcttcatacctcaaatttacatctttga 185  Q
    ||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
30810246 tcatcaccctttacatctttgattctgcttcactctcaatggtaccactctccatttttcaaaaattcgatagcttcatacctcaaatttacatctttga 30810345  T
186 ttctgctttttcttctctccatatctctcgatgtcatcctcacatcacacaattcttctcccccttgtttcata 259  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30810346 ttctgctttttcttctctccatatctctcgatgtcatcctcacatcacacaattcttctcccccttgtttcata 30810419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University