View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20290_low_9 (Length: 277)
Name: NF20290_low_9
Description: NF20290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20290_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 86 - 259
Target Start/End: Original strand, 30810246 - 30810419
Alignment:
| Q |
86 |
tcatcaccctttacatctttgattctgcttctctcttaatggtaccactctccatttttcagaaattcgatagcttcatacctcaaatttacatctttga |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30810246 |
tcatcaccctttacatctttgattctgcttcactctcaatggtaccactctccatttttcaaaaattcgatagcttcatacctcaaatttacatctttga |
30810345 |
T |
 |
| Q |
186 |
ttctgctttttcttctctccatatctctcgatgtcatcctcacatcacacaattcttctcccccttgtttcata |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30810346 |
ttctgctttttcttctctccatatctctcgatgtcatcctcacatcacacaattcttctcccccttgtttcata |
30810419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University