View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20291_low_2 (Length: 252)
Name: NF20291_low_2
Description: NF20291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20291_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 139 - 239
Target Start/End: Original strand, 4105647 - 4105747
Alignment:
| Q |
139 |
ggaaaataactatgtatccaataattcttatatatttttaaatgggaatttttagtattgatcatattttattgaaggtgagaatcaaaccttcgacgtt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4105647 |
ggaaaataactatgtatccaataattcttatatatttctaaatggaaaattttagtattgttcatattttattgaaggtgagaatcaaaccttcgacgtt |
4105746 |
T |
 |
| Q |
239 |
c |
239 |
Q |
| |
|
| |
|
|
| T |
4105747 |
c |
4105747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University