View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20292_high_10 (Length: 217)
Name: NF20292_high_10
Description: NF20292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20292_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 8022411 - 8022613
Alignment:
| Q |
1 |
tgcttccaacaccctgtttctctgattctcccaacaataccgcaagttctttctttgatatctttattttcaccttaccattagcatcagaagaagctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022411 |
tgcttccaacaccctgtttctctgattctcccaacaataccgcaagttctttctttgatatctttattttcaccttaccattagcatcagaagaagctct |
8022510 |
T |
|
| Q |
101 |
tagtgcacctaaaagcttctctttctctatgttccccaaactcaaaccatgaacttcatcaaaaactttgcttgaattcatcctactcttatggtttgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022511 |
tagtgcacctaaaagcttctctttctctatgttccccaaactcaaaccatgaacttcatcaaaaactttgcttgaattcatcctactcttatggtttgat |
8022610 |
T |
|
| Q |
201 |
gtc |
203 |
Q |
| |
|
||| |
|
|
| T |
8022611 |
gtc |
8022613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University