View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20292_low_17 (Length: 228)
Name: NF20292_low_17
Description: NF20292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20292_low_17 |
 | |
|
| [»] scaffold0223 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 13057836 - 13057640
Alignment:
| Q |
17 |
tgaataaatagtttgtgataaactaaagttgagttttgagccgagttaatttttatcgagtcgagttgaactaaatttgactcagataaactcgttttca |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13057836 |
tgaataaatagtttatgataaactaaagttgagttttgagccgagttaatttttatcgagtcgagttgaactaaatttgactcagataaactcgttttca |
13057737 |
T |
|
| Q |
117 |
gtcctagttctaagtagtgataataaaaagaagtaagaataagcagcttcacttgatatgttcttcttttattaaaaaataaaacaggtatgtttgt |
213 |
Q |
| |
|
|||||| ||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13057736 |
gtcctaattctaggcagtgataataaaaagaagtaagaataagcagcttcagttgatatgttcttcttttattaaaaaataaaacaggtatgtttgt |
13057640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 80
Target Start/End: Complemental strand, 31815970 - 31815936
Alignment:
| Q |
46 |
tgagttttgagccgagttaatttttatcgagtcga |
80 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31815970 |
tgagtttcgagccgagttaatttttatcgagtcga |
31815936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 82
Target Start/End: Original strand, 49406368 - 49406404
Alignment:
| Q |
46 |
tgagttttgagccgagttaatttttatcgagtcgagt |
82 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49406368 |
tgagtttcgagccgagttaatttttatcgagtcgagt |
49406404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 85
Target Start/End: Original strand, 4442051 - 4442093
Alignment:
| Q |
43 |
agttgagttttgagccgagttaatttttatcgagtcgagttga |
85 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
4442051 |
agttgagtttcgagccgaattaattcttatcgagtcgagttga |
4442093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 81
Target Start/End: Complemental strand, 17439617 - 17439583
Alignment:
| Q |
47 |
gagttttgagccgagttaatttttatcgagtcgag |
81 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
17439617 |
gagtttcgagccgagttaatttttatcgagtcgag |
17439583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 78
Target Start/End: Complemental strand, 13850 - 13818
Alignment:
| Q |
46 |
tgagttttgagccgagttaatttttatcgagtc |
78 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
13850 |
tgagtttcgagccgagttaatttttatcgagtc |
13818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University