View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20292_low_4 (Length: 410)
Name: NF20292_low_4
Description: NF20292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20292_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 381; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 381; E-Value: 0
Query Start/End: Original strand, 1 - 393
Target Start/End: Original strand, 7499941 - 7500333
Alignment:
| Q |
1 |
cacatccaatccaattaccacaattgttctaaccatgaaaacctagtagatttaaatgaaatatttaagaattggtataaaccttttcaatcaaatataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7499941 |
cacatccaatccaattaccacaattgttctaaccatgaaaacctagtagatttaaatgaaatatttaaaaattggtataaaccttttcaatcaaatataa |
7500040 |
T |
 |
| Q |
101 |
tcctctctccattttgaattgcattcacgagattaatgccagcttgcctccccagttctccggtcatacgctctattccaaactcaacaatcctcacgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
7500041 |
tcctctctccattttgaattgcattcacgagattaatgccagcttgcctccccagttctccggtcatatgctctattccaaacacaacaatcctcacgta |
7500140 |
T |
 |
| Q |
201 |
caaccgatctcctccacctttccagcggcacgtgacattcacctgccatttttgccccaacatcatggtggagtaccccacctcaatcttcgtcaacatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500141 |
caaccgatctcctccacctttccagcggcacgtgacattcacctgccatttttgccccaacatcatggtggagtaccccacctcaatcttcgtcaacatc |
7500240 |
T |
 |
| Q |
301 |
tggttaacccaaagaggtttacaactagaatgaaacaagcctgcagcacggttttgtattgtgtcgataactacccaactcaacctcaaattt |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500241 |
tggttaacccaaagaggtttacaactagaatgaaacaagcctgcagcacggttttgtattgtgtcgataactacccaactcaacctcaaattt |
7500333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University