View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20292_low_9 (Length: 279)
Name: NF20292_low_9
Description: NF20292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20292_low_9 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 279
Target Start/End: Complemental strand, 38748153 - 38747894
Alignment:
| Q |
17 |
aaaaactgtaagagaaaagtttgtttctttgcacacactcctcgtcaattaagaatccttccaattacatcatcttctccatcttcaaatgaacattttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
38748153 |
aaaaactgtaagagaaaagtttgtttctttgcacacactcctcgtcaattaagaatccttccagttacatcatcttc---------aaatgaacattttt |
38748063 |
T |
 |
| Q |
117 |
catgcaacaagaaaaataacaagcttttgaataaccatgttgcttcaaaatcaaacaattgttgtttgttttgtcactgtggtggtaatg------gtaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38748062 |
catgcaacaagaaaaataacaagcttttgaataaccatgttgcttcaaaatcaaacaattgttgtttgttttgtcactgtggtggtaatggtaacggtaa |
38747963 |
T |
 |
| Q |
211 |
tggtaatggtgctaataattctccaacttcaacactttttggtatgtctcatttttcttcacctccggc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747962 |
tggtaatggtgctaataattctccaacttcaacactttttggtatgtctcatttttcttcacctccggc |
38747894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University