View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20293_high_4 (Length: 449)
Name: NF20293_high_4
Description: NF20293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20293_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 18 - 433
Target Start/End: Complemental strand, 50234781 - 50234366
Alignment:
| Q |
18 |
gtttatttgttcagccaacttggtttcggttaggtatttgctgaacgtggagagttccggatattgtcccaaagttttggttatgtccaaacaattaatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50234781 |
gtttatttgttcagccaacttggtttcggttaggtatttgctgaacgtggagagttccggatattgtcccaaagttttggttatgtccaaacaattaatg |
50234682 |
T |
|
| Q |
118 |
gccgaagagaaagacaacataagtgccaagcacaaaacagaggtgtttctcaaacccattgttcttttttcttgctttctcttctttgatcagggacaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50234681 |
gccgaagagaaagacaacataagtgccaagcacagaacagaggtgtttctcaaacccattgttcttttttcttgctttctcttctttgatcagggacaat |
50234582 |
T |
|
| Q |
218 |
cagaaaccaagttggtggtatatgaaattgttgagtttgtaggttttgatgtgtgtaggtatatatatacgtttggtttataaatgtgtggtgtgtggga |
317 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50234581 |
ccgaaaccaagttggtggtatatgaaattgttgagtttgtaggttttgatgtgtgtaggtatatatatgcgtttggtttataaatgtgtggtgtgtggga |
50234482 |
T |
|
| Q |
318 |
ttagtggtcaattttaattatagtaaagtcaaaattgtaacagaaattgtgatctggtggtttaaagagggaagcattttggatggttggccatgctttg |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50234481 |
ttagtggtcaattttaattatagtaaagtcaaaattgtaacagaaattgtgatctggtggtttaaagagggaagcattttggatggttgggcatgctttg |
50234382 |
T |
|
| Q |
418 |
tgactttatgtatatt |
433 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
50234381 |
tgactttatgtgtatt |
50234366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University